Rh2DG519500

Alpha-glucan water dikinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
74312545 .. 74314615
2071 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG519500.1

Sequence Viewer

Length: 222 bp
ATGTATCTCTTTTGTATCTCTTTTGCGACTGTTGCTGTGATTGTTGTGGTGCAAGAGCTGAAGACTAAGATGCAAAGTTCAGGAATGCCTTGGCCTGGTGATGAGGGTGAACAACGATGGGAACAAGCATGGTTGGCTATAAAAAAAGTCATTGTTTTTCTATTCTCCCAGAAAAGTTACAAGCCCCCTAAGAAGACTTTAACAGAAAAGGTGCTTGCGTAA

Protein Analysis

73

Amino Acids

8.38

Weight (kDa)

9.42

Isoelectric Point (pI)

47.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 80
AfiI CCNNNNNNNGG 1 cut(s) 95
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 1 cut(s) 58
AluI AGCT 1 cut(s) 58
AoxI GGCC 1 cut(s) 92
AsuHPI GGTGA 2 cut(s) 110, 119
BbsI GAAGAC 2 cut(s) 68, 200
BccI CCATC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 96
Bme1390I CCNGG 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 96
BmsI GCATC 1 cut(s) 60
BpiI GAAGAC 2 cut(s) 68, 200
BsaJI CCNNGG 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 95
BseBI CCWGG 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 89
BseLI CCNNNNNNNGG 1 cut(s) 95
BshFI GGCC 1 cut(s) 94
BslI CCNNNNNNNGG 1 cut(s) 95
BsmI GAATGC 1 cut(s) 90
BsnI GGCC 1 cut(s) 94
BspANI GGCC 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 89
BssT1I CCWWGG 1 cut(s) 89
Bst2UI CCWGG 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 31
BstC8I GCNNGC 1 cut(s) 216
BstDEI CTNAG 2 cut(s) 66, 189
BstMWI GCNNNNNNNGC 2 cut(s) 32, 134
BstNI CCWGG 1 cut(s) 96
BstSCI CCNGG 1 cut(s) 94
BstV2I GAAGAC 2 cut(s) 68, 200
BsuRI GGCC 1 cut(s) 94
Cac8I GCNNGC 1 cut(s) 216
CviAII CATG 1 cut(s) 129
CviJI RGCY 4 cut(s) 58, 94, 137, 184
CviKI_1 RGCY 4 cut(s) 58, 94, 137, 184
DdeI CTNAG 2 cut(s) 66, 189
Eco130I CCWWGG 1 cut(s) 89
Eco57I CTGAAG 1 cut(s) 80
EcoRII CCWGG 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 89
ErhI CCWWGG 1 cut(s) 89
FaeI CATG 1 cut(s) 132
FaiI YATR 2 cut(s) 130, 140
FatI CATG 1 cut(s) 128
HaeIII GGCC 1 cut(s) 94
Hin1II CATG 1 cut(s) 132
HphI GGTGA 2 cut(s) 110, 119
Hpy166II GTNNAC 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 81
Hpy8I GTNNAC 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 2 cut(s) 52, 73
HpyF10VI GCNNNNNNNGC 2 cut(s) 32, 134
HpyF3I CTNAG 2 cut(s) 66, 189
Hsp92II CATG 1 cut(s) 132
LpnPI CCDG 4 cut(s) 66, 81, 108, 182
LweI GCATC 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 176
MboII GAAGA 2 cut(s) 73, 205
MnlI CCTC 1 cut(s) 97
MseI TTAA 1 cut(s) 200
MspR9I CCNGG 1 cut(s) 96
Mva1269I GAATGC 1 cut(s) 90
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 2 cut(s) 32, 134
NlaIII CATG 1 cut(s) 132
PctI GAATGC 1 cut(s) 90
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
SaqAI TTAA 1 cut(s) 200
ScrFI CCNGG 1 cut(s) 96
SetI ASST 2 cut(s) 60, 213
SfaNI GCATC 1 cut(s) 60
SgeI CNNG 9 cut(s) 65, 93, 102, 107, 108, 137, 141, 181, 193
StyD4I CCNGG 1 cut(s) 94
StyI CCWWGG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 31
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.