RchiOBHm_Chr5g0079971

Pre-mRNA-splicing factor ATP-dependent RNA

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
85817439 .. 85817927
489 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35431

Sequence Viewer

Length: 372 bp
ATGACTACGAAGGAGTATATGCGTGAGGTAACCGTCGTTGATCCCAAATGGCTTGTGGAACTAGCACCCAGGTTCTTCAAAGTGGCTGACCCTACCAAGATGAGTAAGCGCAAGCGTCAAGAGCGTATTGAACCGCTATATGACAGATACCATGAACCAAACTCTTGGCGTATCCATTTTGGGGTCGAAGAAGAAATCACAGCTCCAGCAGTCTCCATCTGGCTCTCTATTTGGAAACATATTTGCCTCTGCACATCTGGTGCAGAGGAGAGAGAAACAAAGGGCCATTTCTTTTGCAAGGGGCAGAAATTCAATTCCATAAAGTTCCAGTGTTGTTTATTTCTTCACAACCGCTTCTGTTTCAACTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

123

Amino Acids

14.73

Weight (kDa)

8.96

Isoelectric Point (pI)

54.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000671)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 134, 352
AclWI GGATC 1 cut(s) 35
AcsI RAATTY 1 cut(s) 308
AfiI CCNNNNNNNGG 1 cut(s) 181
AgsI TTSAA 4 cut(s) 79, 131, 313, 364
AjnI CCWGG 1 cut(s) 68
AluBI AGCT 1 cut(s) 203
AluI AGCT 1 cut(s) 203
Alw26I GTCTC 1 cut(s) 217
AlwI GGATC 1 cut(s) 35
AoxI GGCC 1 cut(s) 283
ApoI RAATTY 1 cut(s) 308
AspLEI GCGC 1 cut(s) 111
AspS9I GGNCC 1 cut(s) 283
BccI CCATC 1 cut(s) 224
BciT130I CCWGG 1 cut(s) 70
BciVI GTATCC 1 cut(s) 182
BcoDI GTCTC 1 cut(s) 217
BfaI CTAG 1 cut(s) 62
BfuI GTATCC 1 cut(s) 182
Bme1390I CCNGG 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 283
BmrFI CCNGG 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 68
Bsc4I CCNNNNNNNGG 1 cut(s) 181
Bse1I ACTGG 1 cut(s) 328
BseBI CCWGG 1 cut(s) 70
BseDI CCNNGG 1 cut(s) 68
BseLI CCNNNNNNNGG 1 cut(s) 181
BseNI ACTGG 1 cut(s) 328
BseRI GAGGAG 1 cut(s) 281
BsgI GTGCAG 2 cut(s) 235, 282
BshFI GGCC 1 cut(s) 285
BslI CCNNNNNNNGG 1 cut(s) 181
BsmAI GTCTC 1 cut(s) 217
BsnI GGCC 1 cut(s) 285
Bsp143I GATC 1 cut(s) 40
BspACI CCGC 2 cut(s) 134, 352
BspANI GGCC 1 cut(s) 285
BspHI TCATGA 1 cut(s) 368
BspPI GGATC 1 cut(s) 35
BsrI ACTGG 1 cut(s) 328
BssECI CCNNGG 1 cut(s) 68
BssMI GATC 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 70
Bst4CI ACNGT 1 cut(s) 34
BstC8I GCNNGC 1 cut(s) 113
BstEII GGTNACC 1 cut(s) 28
BstHHI GCGC 1 cut(s) 111
BstKTI GATC 1 cut(s) 43
BstMAI GTCTC 1 cut(s) 217
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNI CCWGG 1 cut(s) 70
BstPI GGTNACC 1 cut(s) 28
BstSCI CCNGG 1 cut(s) 68
BstXI CCANNNNNNTGG 1 cut(s) 165
BsuI GTATCC 1 cut(s) 182
BsuRI GGCC 1 cut(s) 285
BtsIMutI CAGTG 1 cut(s) 335
Cac8I GCNNGC 1 cut(s) 113
CciI TCATGA 1 cut(s) 368
CfoI GCGC 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 283
CseI GACGC 1 cut(s) 104
CviAII CATG 2 cut(s) 152, 369
CviJI RGCY 5 cut(s) 52, 86, 203, 223, 285
CviKI_1 RGCY 5 cut(s) 52, 86, 203, 223, 285
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco91I GGTNACC 1 cut(s) 28
EcoO65I GGTNACC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 68
FaeI CATG 2 cut(s) 155, 372
FaiI YATR 8 cut(s) 18, 20, 139, 141, 153, 240, 320, 370
FatI CATG 2 cut(s) 151, 368
FspBI CTAG 1 cut(s) 62
GlaI GCGC 1 cut(s) 110
GsuI CTGGAG 1 cut(s) 189
HaeIII GGCC 1 cut(s) 285
HgaI GACGC 1 cut(s) 104
HhaI GCGC 1 cut(s) 111
Hin1II CATG 2 cut(s) 155, 372
Hin6I GCGC 1 cut(s) 109
HinP1I GCGC 1 cut(s) 109
Hpy188III TCNNGA 2 cut(s) 119, 369
Hpy99I CGWCG 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 4
HpyCH4III ACNGT 1 cut(s) 34
HpyCH4V TGCA 3 cut(s) 252, 263, 297
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
Hsp92II CATG 2 cut(s) 155, 372
HspAI GCGC 1 cut(s) 109
Kzo9I GATC 1 cut(s) 40
LmnI GCTCC 1 cut(s) 208
LpnPI CCDG 6 cut(s) 55, 82, 205, 219, 243, 341
MaeI CTAG 1 cut(s) 62
MaeIII GTNAC 1 cut(s) 28
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 4 cut(s) 67, 200, 203, 335
MluCI AATT 2 cut(s) 308, 313
MnlI CCTC 3 cut(s) 19, 257, 259
MspR9I CCNGG 1 cut(s) 70
MvaI CCWGG 1 cut(s) 70
MwoI GCNNNNNNNGC 1 cut(s) 121
NdeII GATC 1 cut(s) 40
NlaIII CATG 2 cut(s) 155, 372
PagI TCATGA 1 cut(s) 368
Psp6I CCWGG 1 cut(s) 68
PspEI GGTNACC 1 cut(s) 28
PspGI CCWGG 1 cut(s) 68
PspPI GGNCC 1 cut(s) 283
Sau3AI GATC 1 cut(s) 40
Sau96I GGNCC 1 cut(s) 283
ScrFI CCNGG 1 cut(s) 70
SetI ASST 3 cut(s) 30, 74, 205
Sse9I AATT 2 cut(s) 308, 313
SsiI CCGC 2 cut(s) 134, 352
SspMI CTAG 1 cut(s) 62
StyD4I CCNGG 1 cut(s) 68
TaaI ACNGT 1 cut(s) 34
TaqI TCGA 1 cut(s) 186
TasI AATT 2 cut(s) 308, 313
TscAI CASTG 1 cut(s) 335
TspDTI ATGAA 1 cut(s) 168
TspRI CASTG 1 cut(s) 335
XapI RAATTY 1 cut(s) 308
XcmI CCANNNNNNNNNTGG 1 cut(s) 52
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.