RchiOBHm_Chr6g0268811

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
26030871 .. 26031248
378 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24113

Sequence Viewer

Length: 180 bp
ATGTGTGCTCGTGATTGGATGAGGAGTGAGATACGAGATGCTCCTAGCACATTAGAGGATGATGTTGATGTTGATGAGGAGTCTTGCCATGATATTGATGATGATCTTACTCTACTTCAGAGGATGCAGGGCGACATTGATACACCCAGAGGAAGAGCACACTCTTCACCTTTATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.78

Weight (kDa)

4.17

Isoelectric Point (pI)

59.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 101
Alw21I GWGCWC 2 cut(s) 10, 160
AsuHPI GGTGA 1 cut(s) 159
BauI CACGAG 1 cut(s) 9
Bbv12I GWGCWC 2 cut(s) 10, 160
BfaI CTAG 1 cut(s) 45
BmsI GCATC 2 cut(s) 28, 114
BsaBI GATNNNNATC 1 cut(s) 102
Bse8I GATNNNNATC 1 cut(s) 102
BseGI GGATG 3 cut(s) 24, 64, 129
BseJI GATNNNNATC 1 cut(s) 102
BseRI GAGGAG 2 cut(s) 37, 92
BsiHKAI GWGCWC 2 cut(s) 10, 160
Bsp1286I GDGCHC 2 cut(s) 10, 160
Bsp143I GATC 1 cut(s) 103
BspQI GCTCTTC 1 cut(s) 148
BssMI GATC 1 cut(s) 103
BssSI CACGAG 1 cut(s) 9
Bst2BI CACGAG 1 cut(s) 9
Bst6I CTCTTC 2 cut(s) 148, 169
BstF5I GGATG 3 cut(s) 24, 64, 129
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BtsCI GGATG 3 cut(s) 24, 64, 129
CviAII CATG 1 cut(s) 89
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
Eam1104I CTCTTC 2 cut(s) 148, 169
EarI CTCTTC 2 cut(s) 148, 169
Eco57I CTGAAG 1 cut(s) 101
FaeI CATG 1 cut(s) 92
FaiI YATR 1 cut(s) 90
FatI CATG 1 cut(s) 88
FokI GGATG 3 cut(s) 31, 71, 136
FspBI CTAG 1 cut(s) 45
Hin1II CATG 1 cut(s) 92
HinfI GANTC 1 cut(s) 80
HphI GGTGA 1 cut(s) 159
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 11
HpyCH4V TGCA 1 cut(s) 127
Hsp92II CATG 1 cut(s) 92
Kzo9I GATC 1 cut(s) 103
LguI GCTCTTC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 2 cut(s) 113, 160
LweI GCATC 2 cut(s) 28, 114
MaeI CTAG 1 cut(s) 45
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MboII GAAGA 2 cut(s) 156, 165
MhlI GDGCHC 2 cut(s) 10, 160
MlyI GAGTC 1 cut(s) 89
MnlI CCTC 5 cut(s) 15, 49, 70, 114, 143
NdeII GATC 1 cut(s) 103
NlaIII CATG 1 cut(s) 92
PciSI GCTCTTC 1 cut(s) 148
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
SapI GCTCTTC 1 cut(s) 148
Sau3AI GATC 1 cut(s) 103
SchI GAGTC 1 cut(s) 89
SduI GDGCHC 2 cut(s) 10, 160
SetI ASST 1 cut(s) 172
SfaNI GCATC 2 cut(s) 28, 114
SgeI CNNG 8 cut(s) 21, 23, 47, 57, 96, 101, 140, 159
SspMI CTAG 1 cut(s) 45
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.