Rh2AG272900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
32470728 .. 32472640
1913 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG272900.1

Sequence Viewer

Length: 297 bp
ATGGCCTCTTCACAATCAACCACCAGTAATGGTGATGCTGGAACGATGGAGAATCAATCGCCTCCAATTCCTATCACATCAACAGAGAATTCGACCATTGCTGCACCACCAACTGAGAACCAGGAGAACTCAACACCAACAGGTACGAATGAGTTGACTAATGTAAACCGCCCAGGGTTTATGAGAGCACCAAAGTCGGTTGTATGGGATCATTTTGAAAAACAGCATCAAATTCTGAAGAATCTAGAAGAGTTAGTGTTGAAAATGATACTGAGTGTAATGGTGAAGATGAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.78

Weight (kDa)

5.59

Isoelectric Point (pI)

46.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AclWI GGATC 1 cut(s) 216
AcsI RAATTY 2 cut(s) 88, 231
AcuI CTGAAG 1 cut(s) 257
AfaI GTAC 1 cut(s) 145
AgsI TTSAA 2 cut(s) 218, 262
AjnI CCWGG 2 cut(s) 120, 172
Alw21I GWGCWC 1 cut(s) 190
AlwI GGATC 1 cut(s) 216
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 101
ApoI RAATTY 2 cut(s) 88, 231
AsuHPI GGTGA 2 cut(s) 44, 295
Bbv12I GWGCWC 1 cut(s) 190
BbvI GCAGC 1 cut(s) 88
BccI CCATC 1 cut(s) 40
BcgI CGANNNNNNTGC 2 cut(s) 177, 211
BciT130I CCWGG 2 cut(s) 122, 174
BfaI CTAG 1 cut(s) 245
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
Bme1390I CCNGG 2 cut(s) 122, 174
BmrFI CCNGG 2 cut(s) 122, 174
BmsI GCATC 2 cut(s) 25, 235
BsaJI CCNNGG 2 cut(s) 172, 173
Bse1I ACTGG 1 cut(s) 24
Bse3DI GCAATG 1 cut(s) 96
BseBI CCWGG 2 cut(s) 122, 174
BseDI CCNNGG 2 cut(s) 172, 173
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 2 cut(s) 105, 263
BseNI ACTGG 1 cut(s) 24
BseXI GCAGC 1 cut(s) 88
BsgI GTGCAG 1 cut(s) 87
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 190
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 190
Bsp143I GATC 1 cut(s) 208
BspACI CCGC 1 cut(s) 169
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 2 cut(s) 106, 264
BspPI GGATC 1 cut(s) 216
BsrDI GCAATG 1 cut(s) 96
BsrI ACTGG 1 cut(s) 24
BssECI CCNNGG 2 cut(s) 172, 173
BssMI GATC 1 cut(s) 208
Bst2UI CCWGG 2 cut(s) 122, 174
Bst6I CTCTTC 2 cut(s) 13, 243
BstDEI CTNAG 2 cut(s) 114, 272
BstKTI GATC 1 cut(s) 211
BstMBI GATC 1 cut(s) 208
BstNI CCWGG 2 cut(s) 122, 174
BstSCI CCNGG 2 cut(s) 120, 172
BstV1I GCAGC 1 cut(s) 88
BsuRI GGCC 1 cut(s) 5
Csp6I GTAC 1 cut(s) 144
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
CviQI GTAC 1 cut(s) 144
DdeI CTNAG 2 cut(s) 114, 272
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
Eam1104I CTCTTC 2 cut(s) 13, 243
EarI CTCTTC 2 cut(s) 13, 243
Eco57I CTGAAG 1 cut(s) 257
EcoRI GAATTC 1 cut(s) 88
EcoRII CCWGG 2 cut(s) 120, 172
FaiI YATR 2 cut(s) 182, 205
Fnu4HI GCNGC 1 cut(s) 102
Fsp4HI GCNGC 1 cut(s) 102
FspBI CTAG 1 cut(s) 245
GluI GCNGC 1 cut(s) 102
HaeIII GGCC 1 cut(s) 5
HincII GTYRAC 1 cut(s) 156
HindII GTYRAC 1 cut(s) 156
HinfI GANTC 2 cut(s) 52, 241
HphI GGTGA 2 cut(s) 44, 295
Hpy166II GTNNAC 2 cut(s) 156, 166
Hpy188I TCNGA 1 cut(s) 237
Hpy188III TCNNGA 1 cut(s) 245
Hpy8I GTNNAC 2 cut(s) 156, 166
HpyCH4V TGCA 1 cut(s) 104
HpyF3I CTNAG 2 cut(s) 114, 272
Kzo9I GATC 1 cut(s) 208
LpnPI CCDG 7 cut(s) 24, 37, 107, 126, 134, 159, 186
Lsp1109I GCAGC 1 cut(s) 88
LweI GCATC 2 cut(s) 25, 235
MaeI CTAG 1 cut(s) 245
MalI GATC 1 cut(s) 210
MboI GATC 1 cut(s) 208
MboII GAAGA 2 cut(s) 250, 260
MhlI GDGCHC 1 cut(s) 190
MluCI AATT 3 cut(s) 66, 88, 231
MnlI CCTC 3 cut(s) 16, 72, 285
MspR9I CCNGG 2 cut(s) 122, 174
MvaI CCWGG 2 cut(s) 122, 174
NdeII GATC 1 cut(s) 208
PasI CCCWGGG 1 cut(s) 173
PfeI GAWTC 2 cut(s) 52, 241
PkrI GCNGC 1 cut(s) 103
Psp6I CCWGG 2 cut(s) 120, 172
PspGI CCWGG 2 cut(s) 120, 172
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SatI GCNGC 1 cut(s) 102
Sau3AI GATC 1 cut(s) 208
ScrFI CCNGG 2 cut(s) 122, 174
SduI GDGCHC 1 cut(s) 190
SetI ASST 2 cut(s) 145, 296
SfaNI GCATC 2 cut(s) 25, 235
SgeI CNNG 8 cut(s) 36, 51, 133, 134, 153, 185, 186, 257
Sse9I AATT 3 cut(s) 66, 88, 231
SsiI CCGC 1 cut(s) 169
SspMI CTAG 1 cut(s) 245
StyD4I CCNGG 2 cut(s) 120, 172
TaqI TCGA 1 cut(s) 92
TasI AATT 3 cut(s) 66, 88, 231
TfiI GAWTC 2 cut(s) 52, 241
TseI GCWGC 1 cut(s) 101
XapI RAATTY 2 cut(s) 88, 231
XbaI TCTAGA 1 cut(s) 244
XspI CTAG 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.