Rw5G039990

Domain of unknown function (DUF4413)

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
70606188 .. 70606922
735 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G039990.1

Sequence Viewer

Length: 735 bp
ATGGCTTCTGCACCAATCAATGATCTTGCTGAAAATGGTGAGAATCAAGTTCCTGCAACAGCTGAGAATGAGAACAATTCTACACCAATCGAGAATGAGAGCAATTCTACACCAATTGAGAATGAGAACAACTCATCACCTGATACAACTACTAACATACGTCAAGAGAGAAAGCCAAGATCTAAAGCATGGGATCATTTTGAAAAAAAAGTAGTTGGTGATAAAAGAAAAGCTATATGTCATCATTGCAAGAGTATGTTATCGGCAGAGAAAAACCATGGTACGACACATTTACATGATCATTTGAAGTCTTGTCTGTATAAAAGGCAAAGAAAGCTAGATCAGTCCATGTTGAATCCTACAAGGTCTACTGATGGTTCTACTAAGCTTGGCACTTATAGCTTTGATCCAAACAATGCTAGGAGGGAACTTGGAAATATGATTATTCTTCATGAGTATCCTTTGGCTATTGTTGATCATGTTGGATTTAGAAGGTATTCTTTTGAGTTACAGCCATTATTTAAGGTTCCTACTCGAAACACAATCAGAAGTGATATATTTAAGATTTTTGAAGTTGAAAAGGAGAAAACTATGAAGCTAATGGATGCTAACAAGAGTAGGATTGCTATCACAACTGACATGTGGACATCTAATAATCAAAAGAGGGGATTTATGGCTATTACATCACATTTCATTGATGAATCATGGATTTTGCAAAGTCGTCTCTTAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

244

Amino Acids

28.11

Weight (kDa)

9.06

Isoelectric Point (pI)

43.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 368
AclWI GGATC 2 cut(s) 201, 401
AfaI GTAC 1 cut(s) 283
AflII CTTAAG 1 cut(s) 727
AflIII ACRYGT 1 cut(s) 639
AgsI TTSAA 5 cut(s) 203, 307, 355, 572, 578
AluBI AGCT 6 cut(s) 62, 233, 337, 388, 402, 598
AluI AGCT 6 cut(s) 62, 233, 337, 388, 402, 598
Alw26I GTCTC 1 cut(s) 728
AlwI GGATC 2 cut(s) 201, 401
Asp700I GAANNNNTTC 1 cut(s) 496
AsuHPI GGTGA 3 cut(s) 50, 129, 230
BccI CCATC 1 cut(s) 368
BciVI GTATCC 1 cut(s) 468
BclI TGATCA 2 cut(s) 298, 475
BcoDI GTCTC 1 cut(s) 728
BfaI CTAG 2 cut(s) 338, 420
BfrI CTTAAG 1 cut(s) 727
BfuI GTATCC 1 cut(s) 468
BglII AGATCT 1 cut(s) 179
BmiI GGNNCC 1 cut(s) 528
BmsI GCATC 1 cut(s) 595
BplI GAGNNNNNCTC 2 cut(s) 116, 148
BsaBI GATNNNNATC 1 cut(s) 626
BsaJI CCNNGG 1 cut(s) 277
Bse3DI GCAATG 1 cut(s) 244
Bse8I GATNNNNATC 1 cut(s) 626
BseDI CCNNGG 1 cut(s) 277
BseGI GGATG 1 cut(s) 610
BseJI GATNNNNATC 1 cut(s) 626
BseMI GCAATG 1 cut(s) 244
BseMII CTCAG 1 cut(s) 54
BsmAI GTCTC 1 cut(s) 728
BsmBI CGTCTC 1 cut(s) 728
Bsp143I GATC 7 cut(s) 22, 179, 193, 298, 340, 406, 475
Bsp19I CCATGG 1 cut(s) 277
BspCNI CTCAG 1 cut(s) 55
BspHI TCATGA 1 cut(s) 451
BspLI GGNNCC 1 cut(s) 528
BspPI GGATC 2 cut(s) 201, 401
BspTI CTTAAG 1 cut(s) 727
BsrDI GCAATG 1 cut(s) 244
BssECI CCNNGG 1 cut(s) 277
BssMI GATC 7 cut(s) 22, 179, 193, 298, 340, 406, 475
BssT1I CCWWGG 1 cut(s) 277
BstAFI CTTAAG 1 cut(s) 727
BstDEI CTNAG 2 cut(s) 63, 384
BstDSI CCRYGG 1 cut(s) 277
BstF5I GGATG 1 cut(s) 610
BstKTI GATC 7 cut(s) 25, 182, 196, 301, 343, 409, 478
BstMAI GTCTC 1 cut(s) 728
BstMBI GATC 7 cut(s) 22, 179, 193, 298, 340, 406, 475
BstMWI GCNNNNNNNGC 2 cut(s) 334, 399
BstNSI RCATGY 1 cut(s) 643
BstX2I RGATCY 1 cut(s) 179
BstYI RGATCY 1 cut(s) 179
BsuI GTATCC 1 cut(s) 468
BtgI CCRYGG 1 cut(s) 277
BtsCI GGATG 1 cut(s) 610
CciI TCATGA 1 cut(s) 451
Csp6I GTAC 1 cut(s) 282
CviAII CATG 8 cut(s) 189, 278, 296, 349, 452, 479, 640, 705
CviQI GTAC 1 cut(s) 282
DdeI CTNAG 2 cut(s) 63, 384
DpnI GATC 7 cut(s) 24, 181, 195, 300, 342, 408, 477
DpnII GATC 7 cut(s) 22, 179, 193, 298, 340, 406, 475
Eco130I CCWWGG 1 cut(s) 277
EcoT14I CCWWGG 1 cut(s) 277
ErhI CCWWGG 1 cut(s) 277
Esp3I CGTCTC 1 cut(s) 728
FaeI CATG 8 cut(s) 192, 281, 299, 352, 455, 482, 643, 708
FalI AAGNNNNNCTT 2 cut(s) 484, 516
FatI CATG 8 cut(s) 188, 277, 295, 348, 451, 478, 639, 704
FbaI TGATCA 2 cut(s) 298, 475
FblI GTMKAC 1 cut(s) 368
FokI GGATG 1 cut(s) 617
FspBI CTAG 2 cut(s) 338, 420
Hin1II CATG 8 cut(s) 192, 281, 299, 352, 455, 482, 643, 708
HindIII AAGCTT 1 cut(s) 386
HinfI GANTC 3 cut(s) 43, 355, 701
HphI GGTGA 3 cut(s) 50, 129, 230
Hpy166II GTNNAC 2 cut(s) 369, 645
Hpy188I TCNGA 1 cut(s) 548
Hpy188III TCNNGA 3 cut(s) 91, 164, 452
Hpy8I GTNNAC 2 cut(s) 369, 645
HpyAV CCTTC 1 cut(s) 486
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 4 cut(s) 11, 56, 249, 715
HpyF10VI GCNNNNNNNGC 2 cut(s) 334, 399
HpyF3I CTNAG 2 cut(s) 63, 384
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 8 cut(s) 192, 281, 299, 352, 455, 482, 643, 708
Ksp22I TGATCA 2 cut(s) 298, 475
Kzo9I GATC 7 cut(s) 22, 179, 193, 298, 340, 406, 475
LpnPI CCDG 2 cut(s) 66, 153
LweI GCATC 1 cut(s) 595
MaeI CTAG 2 cut(s) 338, 420
MaeII ACGT 1 cut(s) 160
MaeIII GTNAC 1 cut(s) 507
MalI GATC 7 cut(s) 24, 181, 195, 300, 342, 408, 477
MboI GATC 7 cut(s) 22, 179, 193, 298, 340, 406, 475
MboII GAAGA 1 cut(s) 440
MfeI CAATTG 1 cut(s) 114
MflI RGATCY 1 cut(s) 179
MluCI AATT 3 cut(s) 76, 103, 114
MmeI TCCRAC 1 cut(s) 463
MnlI CCTC 2 cut(s) 417, 657
MroXI GAANNNNTTC 1 cut(s) 496
MseI TTAA 3 cut(s) 522, 561, 728
MslI CAYNNNNRTG 1 cut(s) 294
MspA1I CMGCKG 1 cut(s) 62
MspCI CTTAAG 1 cut(s) 727
MunI CAATTG 1 cut(s) 114
MwoI GCNNNNNNNGC 2 cut(s) 334, 399
NcoI CCATGG 1 cut(s) 277
NdeII GATC 7 cut(s) 22, 179, 193, 298, 340, 406, 475
NlaIII CATG 8 cut(s) 192, 281, 299, 352, 455, 482, 643, 708
NlaIV GGNNCC 1 cut(s) 528
NspI RCATGY 1 cut(s) 643
PagI TCATGA 1 cut(s) 451
PciI ACATGT 1 cut(s) 639
PdmI GAANNNNTTC 1 cut(s) 496
PfeI GAWTC 3 cut(s) 43, 355, 701
PscI ACATGT 1 cut(s) 639
PspN4I GGNNCC 1 cut(s) 528
PsuI RGATCY 1 cut(s) 179
PvuII CAGCTG 1 cut(s) 62
RsaI GTAC 1 cut(s) 283
RsaNI GTAC 1 cut(s) 282
RseI CAYNNNNRTG 1 cut(s) 294
SaqAI TTAA 3 cut(s) 522, 561, 728
Sau3AI GATC 7 cut(s) 22, 179, 193, 298, 340, 406, 475
SfaNI GCATC 1 cut(s) 595
SmiMI CAYNNNNRTG 1 cut(s) 294
SmlI CTYRAG 1 cut(s) 727
SmoI CTYRAG 1 cut(s) 727
Sse9I AATT 3 cut(s) 76, 103, 114
SspMI CTAG 2 cut(s) 338, 420
StyI CCWWGG 1 cut(s) 277
TaiI ACGT 1 cut(s) 163
TaqI TCGA 2 cut(s) 90, 535
TasI AATT 3 cut(s) 76, 103, 114
TfiI GAWTC 3 cut(s) 43, 355, 701
Tru1I TTAA 3 cut(s) 522, 561, 728
Tru9I TTAA 3 cut(s) 522, 561, 728
TspDTI ATGAA 4 cut(s) 440, 608, 682, 714
Vha464I CTTAAG 1 cut(s) 727
XceI RCATGY 1 cut(s) 643
XmiI GTMKAC 1 cut(s) 368
XmnI GAANNNNTTC 1 cut(s) 496
XspI CTAG 2 cut(s) 338, 420
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.