Rh5AG424400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
73222840 .. 73234356
11517 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG424400.1

Sequence Viewer

Length: 327 bp
ATGGAGAATCAATCGCCTCCAATTCCTATCACATCAACAGAGAATTCGACCATTGCTGGACCACCAACTGAGAACCAGGAGAACTCAACACCAACAGGTACGAAGGAGTTGACTAATGTAAACCGCCCAGGGTTTATGAGAGCACCAAAGTCGGTTGTATGGGATCATTTTGAAAAACAGGTAATTGGTGGTAAAAGAAAAGCTGTGTGCAACCATTCATCAAATTCTGAAGAATCTAGAAGAGTTAGTGTTGAAAATGATACCGAGTGTAATGGTGAAGATGAGGGTTCTTGCAATGATTTAGAGAACATCACATTATTCGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

11.89

Weight (kDa)

4.72

Isoelectric Point (pI)

55.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 124
AclWI GGATC 1 cut(s) 171
AcsI RAATTY 2 cut(s) 43, 223
AcuI CTGAAG 1 cut(s) 249
AfaI GTAC 1 cut(s) 100
AgsI TTSAA 2 cut(s) 173, 254
AjnI CCWGG 2 cut(s) 75, 127
AluBI AGCT 1 cut(s) 203
AluI AGCT 1 cut(s) 203
Alw21I GWGCWC 1 cut(s) 145
AlwI GGATC 1 cut(s) 171
ApoI RAATTY 2 cut(s) 43, 223
AspS9I GGNCC 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 287
AsuII TTCGAA 1 cut(s) 321
AvaII GGWCC 1 cut(s) 59
Bbv12I GWGCWC 1 cut(s) 145
BcgI CGANNNNNNTGC 2 cut(s) 132, 166
BciT130I CCWGG 2 cut(s) 77, 129
BfaI CTAG 1 cut(s) 237
Bme1390I CCNGG 2 cut(s) 77, 129
Bme18I GGWCC 1 cut(s) 59
BmgT120I GGNCC 1 cut(s) 59
BmrFI CCNGG 2 cut(s) 77, 129
Bpu14I TTCGAA 1 cut(s) 321
BsaJI CCNNGG 2 cut(s) 127, 128
Bse3DI GCAATG 2 cut(s) 51, 301
BseBI CCWGG 2 cut(s) 77, 129
BseDI CCNNGG 2 cut(s) 127, 128
BseMI GCAATG 2 cut(s) 51, 301
BseMII CTCAG 1 cut(s) 60
BsiHKAI GWGCWC 1 cut(s) 145
Bsp119I TTCGAA 1 cut(s) 321
Bsp1286I GDGCHC 1 cut(s) 145
Bsp143I GATC 1 cut(s) 163
BspACI CCGC 1 cut(s) 124
BspCNI CTCAG 1 cut(s) 61
BspPI GGATC 1 cut(s) 171
BspT104I TTCGAA 1 cut(s) 321
BsrDI GCAATG 2 cut(s) 51, 301
BssECI CCNNGG 2 cut(s) 127, 128
BssMI GATC 1 cut(s) 163
Bst2UI CCWGG 2 cut(s) 77, 129
Bst6I CTCTTC 1 cut(s) 235
BstBI TTCGAA 1 cut(s) 321
BstDEI CTNAG 1 cut(s) 69
BstKTI GATC 1 cut(s) 166
BstMBI GATC 1 cut(s) 163
BstNI CCWGG 2 cut(s) 77, 129
BstSCI CCNGG 2 cut(s) 75, 127
Cfr13I GGNCC 1 cut(s) 59
Csp6I GTAC 1 cut(s) 99
CviJI RGCY 1 cut(s) 203
CviKI_1 RGCY 1 cut(s) 203
CviQI GTAC 1 cut(s) 99
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eam1104I CTCTTC 1 cut(s) 235
EarI CTCTTC 1 cut(s) 235
Eco47I GGWCC 1 cut(s) 59
Eco57I CTGAAG 1 cut(s) 249
EcoRI GAATTC 1 cut(s) 43
EcoRII CCWGG 2 cut(s) 75, 127
FaiI YATR 2 cut(s) 137, 160
FspBI CTAG 1 cut(s) 237
HincII GTYRAC 1 cut(s) 111
HindII GTYRAC 1 cut(s) 111
HinfI GANTC 2 cut(s) 7, 233
HphI GGTGA 1 cut(s) 287
Hpy166II GTNNAC 2 cut(s) 111, 121
Hpy188I TCNGA 1 cut(s) 229
Hpy188III TCNNGA 1 cut(s) 237
Hpy8I GTNNAC 2 cut(s) 111, 121
HpyAV CCTTC 1 cut(s) 97
HpyCH4V TGCA 2 cut(s) 210, 294
HpyF3I CTNAG 1 cut(s) 69
Kzo9I GATC 1 cut(s) 163
LpnPI CCDG 7 cut(s) 42, 62, 81, 89, 114, 141, 164
MaeI CTAG 1 cut(s) 237
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 3 cut(s) 242, 252, 290
MhlI GDGCHC 1 cut(s) 145
MluCI AATT 4 cut(s) 21, 43, 183, 223
MnlI CCTC 2 cut(s) 27, 277
MspR9I CCNGG 2 cut(s) 77, 129
MvaI CCWGG 2 cut(s) 77, 129
NdeII GATC 1 cut(s) 163
NspV TTCGAA 1 cut(s) 321
PasI CCCWGGG 1 cut(s) 128
PfeI GAWTC 2 cut(s) 7, 233
Psp6I CCWGG 2 cut(s) 75, 127
PspGI CCWGG 2 cut(s) 75, 127
PspPI GGNCC 1 cut(s) 59
RsaI GTAC 1 cut(s) 100
RsaNI GTAC 1 cut(s) 99
Sau3AI GATC 1 cut(s) 163
Sau96I GGNCC 1 cut(s) 59
ScrFI CCNGG 2 cut(s) 77, 129
SduI GDGCHC 1 cut(s) 145
SetI ASST 3 cut(s) 100, 183, 205
SfuI TTCGAA 1 cut(s) 321
SinI GGWCC 1 cut(s) 59
Sse9I AATT 4 cut(s) 21, 43, 183, 223
SsiI CCGC 1 cut(s) 124
SspMI CTAG 1 cut(s) 237
StyD4I CCNGG 2 cut(s) 75, 127
TaqI TCGA 2 cut(s) 47, 321
TasI AATT 4 cut(s) 21, 43, 183, 223
TfiI GAWTC 2 cut(s) 7, 233
TspDTI ATGAA 1 cut(s) 207
VpaK11BI GGWCC 1 cut(s) 59
XapI RAATTY 2 cut(s) 43, 223
XbaI TCTAGA 1 cut(s) 236
XspI CTAG 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.