Rh5AG393600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
68222686 .. 68239522
16837 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG393600.1

Sequence Viewer

Length: 186 bp
ATGAGCTATGTGGAAGAGGTGAAGGAGATATGGAATGGATGGACAGGTGGAGGAGGCGAAGGAGGTGGTGATGGGAATGGTGGTATGGAAGATATGTCATATAGCTGTGCTAATAATGAAATAATGGATGAGGATGTAGAGCAAAGGGTTCCACGCAAAAGAAAGAGGAAAGCAGCAATAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.71

Weight (kDa)

4.64

Isoelectric Point (pI)

67.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 6, 105
AluI AGCT 2 cut(s) 6, 105
ApeKI GCWGC 1 cut(s) 173
AsuHPI GGTGA 2 cut(s) 31, 80
BccI CCATC 2 cut(s) 33, 65
BisI GCNGC 1 cut(s) 174
BlsI GCNGC 1 cut(s) 175
BmiI GGNNCC 1 cut(s) 150
BseGI GGATG 3 cut(s) 44, 133, 139
BseRI GAGGAG 1 cut(s) 66
BspLI GGNNCC 1 cut(s) 150
Bst6I CTCTTC 1 cut(s) 9
BstF5I GGATG 3 cut(s) 44, 133, 139
BtsCI GGATG 3 cut(s) 44, 133, 139
CviJI RGCY 2 cut(s) 6, 105
CviKI_1 RGCY 2 cut(s) 6, 105
Eam1104I CTCTTC 1 cut(s) 9
EarI CTCTTC 1 cut(s) 9
FaiI YATR 6 cut(s) 9, 31, 86, 95, 100, 102
Fnu4HI GCNGC 1 cut(s) 174
FokI GGATG 3 cut(s) 51, 140, 146
Fsp4HI GCNGC 1 cut(s) 174
GluI GCNGC 1 cut(s) 174
HphI GGTGA 2 cut(s) 31, 80
HpyAV CCTTC 2 cut(s) 16, 53
LpnPI CCDG 1 cut(s) 30
MboII GAAGA 2 cut(s) 26, 101
MluCI AATT 1 cut(s) 181
MnlI CCTC 6 cut(s) 10, 44, 47, 56, 124, 159
NlaIV GGNNCC 1 cut(s) 150
PkrI GCNGC 1 cut(s) 175
PspN4I GGNNCC 1 cut(s) 150
SatI GCNGC 1 cut(s) 174
SetI ASST 5 cut(s) 8, 21, 49, 67, 107
SgeI CNNG 2 cut(s) 57, 165
Sse9I AATT 1 cut(s) 181
TasI AATT 1 cut(s) 181
TseI GCWGC 1 cut(s) 173
TspDTI ATGAA 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.