Rh3BG262200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
25388221 .. 25395486
7266 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG262200.1

Sequence Viewer

Length: 156 bp
ATGAATCGCTTACTTTGGTTGAATGTTTCTCTAAGTATGGAAGATATGTCATATAGCTGTGCTAATAATGAAATAATGGATGAGGACGTGGAACAAAGTGTTCCACGCAAAAGAAAGAGGAAAGCAGCATTATTTACTAACTTAACACTAAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.99

Weight (kDa)

7.9

Isoelectric Point (pI)

66.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 22
AjiI CACGTC 1 cut(s) 88
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
ApeKI GCWGC 1 cut(s) 125
BbvI GCAGC 1 cut(s) 137
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
BmgBI CACGTC 1 cut(s) 88
BseGI GGATG 1 cut(s) 85
BseXI GCAGC 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 32
BstF5I GGATG 1 cut(s) 85
BstV1I GCAGC 1 cut(s) 137
BtrI CACGTC 1 cut(s) 88
BtsCI GGATG 1 cut(s) 85
CviJI RGCY 1 cut(s) 57
CviKI_1 RGCY 1 cut(s) 57
DdeI CTNAG 1 cut(s) 32
FaiI YATR 4 cut(s) 38, 47, 52, 54
Fnu4HI GCNGC 1 cut(s) 126
FokI GGATG 1 cut(s) 92
Fsp4HI GCNGC 1 cut(s) 126
FspEI CC 6 cut(s) 23, 62, 68, 74, 103, 117
GluI GCNGC 1 cut(s) 126
HinfI GANTC 1 cut(s) 4
HpyCH4IV ACGT 1 cut(s) 87
HpyF3I CTNAG 1 cut(s) 32
HpySE526I ACGT 1 cut(s) 87
Lsp1109I GCAGC 1 cut(s) 137
MaeII ACGT 1 cut(s) 87
MboII GAAGA 1 cut(s) 53
MnlI CCTC 2 cut(s) 76, 111
MseI TTAA 1 cut(s) 143
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 1 cut(s) 127
SaqAI TTAA 1 cut(s) 143
SatI GCNGC 1 cut(s) 126
SetI ASST 2 cut(s) 59, 90
SgeI CNNG 2 cut(s) 100, 117
TaiI ACGT 1 cut(s) 90
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TseI GCWGC 1 cut(s) 125
TspDTI ATGAA 2 cut(s) 17, 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.