Rh7DG303500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
35073104 .. 35114893
41790 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG303500.1

Sequence Viewer

Length: 162 bp
ATGGATGAAAAAGAACTACTAAAAGAGAAGAAAAGAGTTAGGAAACGTCCCTGGTGTATAAATATGGAACCGACATACACAGAGGCTAGTGGAGCAGAACCAATTGAAATCTCAAATGAAAATGAGATAGACTCAAAGCTTCAAGGTGATGCAGATACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.14

Weight (kDa)

4.71

Isoelectric Point (pI)

50.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 107, 143
AjnI CCWGG 1 cut(s) 50
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
AsuHPI GGTGA 1 cut(s) 158
BciT130I CCWGG 1 cut(s) 52
BfaI CTAG 1 cut(s) 87
Bme1390I CCNGG 1 cut(s) 52
BmiI GGNNCC 1 cut(s) 69
BmrFI CCNGG 1 cut(s) 52
BmsI GCATC 1 cut(s) 139
BplI GAGNNNNNCTC 2 cut(s) 116, 148
BsaJI CCNNGG 1 cut(s) 50
BseBI CCWGG 1 cut(s) 52
BseDI CCNNGG 1 cut(s) 50
BseGI GGATG 1 cut(s) 10
BslFI GGGAC 1 cut(s) 33
BsmFI GGGAC 1 cut(s) 33
BspLI GGNNCC 1 cut(s) 69
BssECI CCNNGG 1 cut(s) 50
Bst2UI CCWGG 1 cut(s) 52
BstF5I GGATG 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNI CCWGG 1 cut(s) 52
BstSCI CCNGG 1 cut(s) 50
BtsCI GGATG 1 cut(s) 10
CviJI RGCY 2 cut(s) 86, 139
CviKI_1 RGCY 2 cut(s) 86, 139
EcoRII CCWGG 1 cut(s) 50
FaiI YATR 3 cut(s) 59, 65, 76
FaqI GGGAC 1 cut(s) 33
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 87
HindIII AAGCTT 1 cut(s) 137
HinfI GANTC 1 cut(s) 131
HphI GGTGA 1 cut(s) 158
HpyCH4IV ACGT 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
HpySE526I ACGT 1 cut(s) 46
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 2 cut(s) 37, 64
LweI GCATC 1 cut(s) 139
MaeI CTAG 1 cut(s) 87
MaeII ACGT 1 cut(s) 46
MboII GAAGA 1 cut(s) 40
MfeI CAATTG 1 cut(s) 102
MluCI AATT 1 cut(s) 102
MlyI GAGTC 1 cut(s) 125
MnlI CCTC 1 cut(s) 76
MseI TTAA 1 cut(s) 160
MspR9I CCNGG 1 cut(s) 52
MunI CAATTG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 52
MwoI GCNNNNNNNGC 1 cut(s) 92
NlaIV GGNNCC 1 cut(s) 69
PleI GAGTC 1 cut(s) 125
PpsI GAGTC 1 cut(s) 125
Psp6I CCWGG 1 cut(s) 50
PspGI CCWGG 1 cut(s) 50
PspN4I GGNNCC 1 cut(s) 69
SaqAI TTAA 1 cut(s) 160
SchI GAGTC 1 cut(s) 125
ScrFI CCNGG 1 cut(s) 52
SetI ASST 3 cut(s) 49, 141, 148
SfaNI GCATC 1 cut(s) 139
SgeI CNNG 4 cut(s) 63, 64, 99, 155
Sse9I AATT 1 cut(s) 102
SspMI CTAG 1 cut(s) 87
StyD4I CCNGG 1 cut(s) 50
TaiI ACGT 1 cut(s) 49
TasI AATT 1 cut(s) 102
Tru1I TTAA 1 cut(s) 160
Tru9I TTAA 1 cut(s) 160
TspDTI ATGAA 2 cut(s) 21, 132
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.