Rh3CG359000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
44397831 .. 44399100
1270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG359000.1

Sequence Viewer

Length: 198 bp
ATGCTTGATTTGATTTTCAGGAAGTGGGTTTTGCGATTCATTGTGGAAGATATGTCATATAGCTGTGCTAATAATGAAATAATGGATGAGGATGTGGAACAAAGGGTTCCACGCAAAAGAAAGAGGAAAGCAGCAGTATGGGATAATTTTGAAGTAAAAGTGATCAAGGGGGAAGAGAAAGCAATTTTATATGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.89

Weight (kDa)

6.3

Isoelectric Point (pI)

44.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 152
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
ApeKI GCWGC 1 cut(s) 131
BbvI GCAGC 1 cut(s) 143
BclI TGATCA 1 cut(s) 162
BisI GCNGC 1 cut(s) 132
BlsI GCNGC 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 108
BseGI GGATG 2 cut(s) 91, 97
BseXI GCAGC 1 cut(s) 143
Bsp143I GATC 1 cut(s) 162
BspLI GGNNCC 1 cut(s) 108
BssMI GATC 1 cut(s) 162
Bst6I CTCTTC 1 cut(s) 168
BstF5I GGATG 2 cut(s) 91, 97
BstKTI GATC 1 cut(s) 165
BstMBI GATC 1 cut(s) 162
BstV1I GCAGC 1 cut(s) 143
BtsCI GGATG 2 cut(s) 91, 97
CviJI RGCY 1 cut(s) 63
CviKI_1 RGCY 1 cut(s) 63
DpnI GATC 1 cut(s) 164
DpnII GATC 1 cut(s) 162
Eam1104I CTCTTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 168
FaiI YATR 6 cut(s) 53, 58, 60, 139, 190, 192
FbaI TGATCA 1 cut(s) 162
Fnu4HI GCNGC 1 cut(s) 132
FokI GGATG 2 cut(s) 98, 104
Fsp4HI GCNGC 1 cut(s) 132
GluI GCNGC 1 cut(s) 132
HinfI GANTC 1 cut(s) 36
Hpy188III TCNNGA 1 cut(s) 19
Ksp22I TGATCA 1 cut(s) 162
Kzo9I GATC 1 cut(s) 162
LpnPI CCDG 1 cut(s) 4
Lsp1109I GCAGC 1 cut(s) 143
MalI GATC 1 cut(s) 164
MboI GATC 1 cut(s) 162
MboII GAAGA 2 cut(s) 59, 185
MluCI AATT 2 cut(s) 145, 183
MnlI CCTC 2 cut(s) 82, 117
NdeII GATC 1 cut(s) 162
NlaIV GGNNCC 1 cut(s) 108
PfeI GAWTC 1 cut(s) 36
PkrI GCNGC 1 cut(s) 133
PspN4I GGNNCC 1 cut(s) 108
SatI GCNGC 1 cut(s) 132
Sau3AI GATC 1 cut(s) 162
SetI ASST 1 cut(s) 65
SgeI CNNG 4 cut(s) 17, 31, 123, 178
Sse9I AATT 2 cut(s) 145, 183
TasI AATT 2 cut(s) 145, 183
TfiI GAWTC 1 cut(s) 36
TseI GCWGC 1 cut(s) 131
TspDTI ATGAA 2 cut(s) 28, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.