Rh4BG049500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
8827425 .. 8856621
29197 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG049500.1

Sequence Viewer

Length: 204 bp
ATGCTTATTTGTACAAACAATGTAGAAAGACAAATTGAGGTAAAAACAGCATCAAATTCTGAAGAATCTAGGAGAGTTAGTGTTGAAAATGATACTGAGTGTAATGGTGAAGATGAGCTTCTGTTTGAGGAAAATCCCCTGCATTCAAACATATCTATCAAAATGGCTATACAAATTTATCAGATTCTGCTTGTCATTGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.64

Weight (kDa)

4.4

Isoelectric Point (pI)

69.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 55, 174
AcuI CTGAAG 1 cut(s) 81
AfaI GTAC 1 cut(s) 13
AgsI TTSAA 2 cut(s) 86, 147
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
AlwNI CAGNNNCTG 1 cut(s) 187
ApoI RAATTY 2 cut(s) 55, 174
AsuHPI GGTGA 1 cut(s) 119
BfaI CTAG 1 cut(s) 69
BmsI GCATC 1 cut(s) 59
BsaXI ACNNNNNCTCC 2 cut(s) 64, 94
Bse3DI GCAATG 1 cut(s) 195
BseMI GCAATG 1 cut(s) 195
BseMII CTCAG 1 cut(s) 87
BsmI GAATGC 1 cut(s) 142
Bsp1407I TGTACA 1 cut(s) 11
BspCNI CTCAG 1 cut(s) 88
BsrDI GCAATG 1 cut(s) 195
BsrGI TGTACA 1 cut(s) 11
BstAUI TGTACA 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 96
CaiI CAGNNNCTG 1 cut(s) 187
Csp6I GTAC 1 cut(s) 12
CviJI RGCY 2 cut(s) 118, 167
CviKI_1 RGCY 2 cut(s) 118, 167
CviQI GTAC 1 cut(s) 12
DdeI CTNAG 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 81
FaiI YATR 2 cut(s) 152, 170
FalI AAGNNNNNCTT 2 cut(s) 102, 134
FspBI CTAG 1 cut(s) 69
FspEI CC 8 cut(s) 23, 55, 90, 113, 149, 150, 151, 152
HinfI GANTC 2 cut(s) 65, 184
HphI GGTGA 1 cut(s) 119
Hpy188I TCNGA 2 cut(s) 61, 183
HpyCH4V TGCA 1 cut(s) 142
HpyF3I CTNAG 1 cut(s) 96
LpnPI CCDG 1 cut(s) 152
LweI GCATC 1 cut(s) 59
MaeI CTAG 1 cut(s) 69
MboII GAAGA 2 cut(s) 74, 122
MluCI AATT 3 cut(s) 33, 55, 174
MnlI CCTC 2 cut(s) 31, 121
Mva1269I GAATGC 1 cut(s) 142
PctI GAATGC 1 cut(s) 142
PfeI GAWTC 2 cut(s) 65, 184
PstNI CAGNNNCTG 1 cut(s) 187
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
SetI ASST 2 cut(s) 42, 120
SfaNI GCATC 1 cut(s) 59
SgeI CNNG 2 cut(s) 81, 151
Sse9I AATT 3 cut(s) 33, 55, 174
SspMI CTAG 1 cut(s) 69
TasI AATT 3 cut(s) 33, 55, 174
TatI WGTACW 1 cut(s) 11
TfiI GAWTC 2 cut(s) 65, 184
XapI RAATTY 2 cut(s) 55, 174
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.