Rh2AG204500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
20658233 .. 20665776
7544 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG204500.1

Sequence Viewer

Length: 348 bp
ATGGCCTCTTCACAATCAACCACCACTAATGTTGATGCTGGAACGATGGAGAATCAATCGCCTCCAATTCCTATCACATCAACAGAGAATTCGACCATTGCTGCACCACCAACTGAGAACCAGGAGAACTCAACACCAACAGGTACGAATGAGTTGACTAAAGTAAACCGCCCAGGGTTTATGAGAGCACCAAAGTCGGTTGTATGGGATCATTTTGAAAAACAGGTAATTGGTGGTAAAAGAAAAGCTGTGTGCAACCATTCATCAAATTCTGAAGAATCTAGAAGAGTTAGTGTTGAAAATGATACCGAGTGTAATGGTGAAGATGAGGGTACGTTCTTGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.47

Weight (kDa)

4.83

Isoelectric Point (pI)

55.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AclWI GGATC 1 cut(s) 216
AcsI RAATTY 2 cut(s) 88, 268
AcuI CTGAAG 1 cut(s) 294
AfaI GTAC 2 cut(s) 145, 334
AgsI TTSAA 2 cut(s) 218, 299
AjnI CCWGG 2 cut(s) 120, 172
AluBI AGCT 1 cut(s) 248
AluI AGCT 1 cut(s) 248
Alw21I GWGCWC 1 cut(s) 190
AlwI GGATC 1 cut(s) 216
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 101
ApoI RAATTY 2 cut(s) 88, 268
AsuHPI GGTGA 1 cut(s) 332
Bbv12I GWGCWC 1 cut(s) 190
BbvI GCAGC 1 cut(s) 88
BccI CCATC 1 cut(s) 40
BcgI CGANNNNNNTGC 2 cut(s) 177, 211
BciT130I CCWGG 2 cut(s) 122, 174
BfaI CTAG 1 cut(s) 282
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
Bme1390I CCNGG 2 cut(s) 122, 174
BmrFI CCNGG 2 cut(s) 122, 174
BmsI GCATC 1 cut(s) 25
BsaJI CCNNGG 2 cut(s) 172, 173
Bse3DI GCAATG 1 cut(s) 96
BseBI CCWGG 2 cut(s) 122, 174
BseDI CCNNGG 2 cut(s) 172, 173
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 105
BseXI GCAGC 1 cut(s) 88
BsgI GTGCAG 1 cut(s) 87
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 190
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 190
Bsp143I GATC 1 cut(s) 208
BspACI CCGC 1 cut(s) 169
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 106
BspPI GGATC 1 cut(s) 216
BsrDI GCAATG 1 cut(s) 96
BssECI CCNNGG 2 cut(s) 172, 173
BssMI GATC 1 cut(s) 208
Bst2UI CCWGG 2 cut(s) 122, 174
Bst6I CTCTTC 2 cut(s) 13, 280
BstDEI CTNAG 1 cut(s) 114
BstKTI GATC 1 cut(s) 211
BstMBI GATC 1 cut(s) 208
BstNI CCWGG 2 cut(s) 122, 174
BstSCI CCNGG 2 cut(s) 120, 172
BstV1I GCAGC 1 cut(s) 88
BsuRI GGCC 1 cut(s) 5
Csp6I GTAC 2 cut(s) 144, 333
CspCI CAANNNNNGTGG 2 cut(s) 13, 48
CviJI RGCY 2 cut(s) 5, 248
CviKI_1 RGCY 2 cut(s) 5, 248
CviQI GTAC 2 cut(s) 144, 333
DdeI CTNAG 1 cut(s) 114
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
Eam1104I CTCTTC 2 cut(s) 13, 280
EarI CTCTTC 2 cut(s) 13, 280
Eco57I CTGAAG 1 cut(s) 294
EcoRI GAATTC 1 cut(s) 88
EcoRII CCWGG 2 cut(s) 120, 172
FaiI YATR 2 cut(s) 182, 205
Fnu4HI GCNGC 1 cut(s) 102
Fsp4HI GCNGC 1 cut(s) 102
FspBI CTAG 1 cut(s) 282
GluI GCNGC 1 cut(s) 102
HaeIII GGCC 1 cut(s) 5
HincII GTYRAC 1 cut(s) 156
HindII GTYRAC 1 cut(s) 156
HinfI GANTC 2 cut(s) 52, 278
HphI GGTGA 1 cut(s) 332
Hpy166II GTNNAC 2 cut(s) 156, 166
Hpy188I TCNGA 1 cut(s) 274
Hpy188III TCNNGA 1 cut(s) 282
Hpy8I GTNNAC 2 cut(s) 156, 166
HpyCH4IV ACGT 1 cut(s) 335
HpyCH4V TGCA 3 cut(s) 104, 255, 343
HpyF3I CTNAG 1 cut(s) 114
HpySE526I ACGT 1 cut(s) 335
Kzo9I GATC 1 cut(s) 208
LpnPI CCDG 7 cut(s) 24, 107, 126, 134, 159, 186, 209
Lsp1109I GCAGC 1 cut(s) 88
LweI GCATC 1 cut(s) 25
MaeI CTAG 1 cut(s) 282
MaeII ACGT 1 cut(s) 335
MalI GATC 1 cut(s) 210
MboI GATC 1 cut(s) 208
MboII GAAGA 3 cut(s) 287, 297, 335
MhlI GDGCHC 1 cut(s) 190
MluCI AATT 4 cut(s) 66, 88, 228, 268
MnlI CCTC 3 cut(s) 16, 72, 322
MspR9I CCNGG 2 cut(s) 122, 174
MvaI CCWGG 2 cut(s) 122, 174
NdeII GATC 1 cut(s) 208
PasI CCCWGGG 1 cut(s) 173
PfeI GAWTC 2 cut(s) 52, 278
PkrI GCNGC 1 cut(s) 103
Psp6I CCWGG 2 cut(s) 120, 172
PspGI CCWGG 2 cut(s) 120, 172
RsaI GTAC 2 cut(s) 145, 334
RsaNI GTAC 2 cut(s) 144, 333
SatI GCNGC 1 cut(s) 102
Sau3AI GATC 1 cut(s) 208
ScrFI CCNGG 2 cut(s) 122, 174
SduI GDGCHC 1 cut(s) 190
SetI ASST 4 cut(s) 145, 228, 250, 338
SfaNI GCATC 1 cut(s) 25
SgeI CNNG 9 cut(s) 51, 133, 134, 153, 185, 186, 236, 294, 322
Sse9I AATT 4 cut(s) 66, 88, 228, 268
SsiI CCGC 1 cut(s) 169
SspMI CTAG 1 cut(s) 282
StyD4I CCNGG 2 cut(s) 120, 172
TaiI ACGT 1 cut(s) 338
TaqI TCGA 1 cut(s) 92
TasI AATT 4 cut(s) 66, 88, 228, 268
TfiI GAWTC 2 cut(s) 52, 278
TseI GCWGC 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 252
XapI RAATTY 2 cut(s) 88, 268
XbaI TCTAGA 1 cut(s) 281
XspI CTAG 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.