Rmu_co7986250.1_g000001

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7986250.1
Physical Location & Seq
Reverse (-)
2 .. 369
368 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7986250.1_g000001.1.cds

Sequence Viewer

Length: 368 bp
atgccaaatgttttgcagaatggcaagtatccccaatccattcttttctttgatactcgagaaggaaataaaccaggagaggaaataggctactttctttgcaagggcattgctggtagtttctttcagcagttgctggttcttgacttggagcgtgtattcagacctcaattaccgaccaccataggtaaattaaagaagctgaaatatctaggcttaaggtggacatacctagaggaaatgccatcatctataggcaatttggtggaactccaaactctagaattgaagcatactagtattacaactatctcaacttcaatttggaaactgaagaaccttctgcacctgtactcgaatgagaattg

Protein Analysis

122

Amino Acids

14.05

Weight (kDa)

9.04

Isoelectric Point (pI)

40.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000657)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g34770
malus_domestica MD17G1025700.v1.1
prunus_persica Prupe.3G040600_v2.0.a1 Prupe.3G040800_v2.0.a1 Prupe.3G041000_v2.0.a1 Prupe.3G041100_v2.0.a1 Prupe.3G041500_v2.0.a1 Prupe.4G109400_v2.0.a1 Prupe.8G037400_v2.0.a1 Prupe.8G037400_v2.0.a1 Prupe.8G037700_v2.0.a1
pyrus_communis pycom09g10040 pycom17g16000
rosa_chinensis RchiOBHm_Chr2g0145591 RchiOBHm_Chr2g0145611
rosa_laevigata RLG00000020146 RLG00000020149 RLG00000020151 RLG00000020154
rosa_multiflora Rmu_co7986250.1_g000001 Rmu_co8305779.1_g000001 Rmu_sc0002718.1_g000011 Rmu_sc0002835.1_g000009 Rmu_sc0002835.1_g000016 Rmu_sc0003046.1_g000007 Rmu_sc0003046.1_g000010 Rmu_sc0004445.1_g000006 Rmu_sc0004810.1_g000002 Rmu_sc0006477.1_g000008 Rmu_sc0014329.1_g000001 Rmu_sc0020976.1_g000003 Rmu_sc0021168.1_g000001 Rmu_sc0022199.1_g000001 Rmu_sc0036991.1_g000001 Rmu_sc0041497.1_g000003
rosa_roxburghii Rroxscaffold_152G00434560 Rroxscaffold_152G00434570 Rroxscaffold_152G00434600 Rroxscaffold_152G00434610 Rroxscaffold_2G00100630 Rroxscaffold_2G00100640 Rroxscaffold_2G00100660 Rroxscaffold_2G00100670 Rroxscaffold_2G00100680 Rroxscaffold_2G00100690
rosa_rugosa Rorug02G0392300 Rorug02G0392400 Rorug02G0392400
rosa_samantha Rh2AG445700 Rh2AG445800 Rh2AG446000 Rh2AG446100 Rh2AG446300 Rh2AG446600 Rh2BG457400 Rh2BG457500 Rh2BG457600 Rh2BG457900 Rh2BG458300 Rh2CG432300 Rh2CG432400 Rh2CG432500 Rh2CG432700 Rh2CG432900 Rh2CG433000 Rh2CG433300 Rh2DG467100 Rh2DG467200 Rh2DG467300 Rh2DG467600 Rh2DG467900 Rh3DG194100
rosa_wichuraiana Rw2G036420 Rw2G036450 Rw2G036470 Rw3G014900 Rw3G014920

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 353
AfaI GTAC 1 cut(s) 353
AflII CTTAAG 1 cut(s) 217
AgsI TTSAA 2 cut(s) 289, 321
AhlI ACTAGT 1 cut(s) 296
AjnI CCWGG 1 cut(s) 73
AluBI AGCT 1 cut(s) 202
AluI AGCT 1 cut(s) 202
AlwNI CAGNNNCTG 1 cut(s) 136
Ama87I CYCGRG 1 cut(s) 57
AvaI CYCGRG 1 cut(s) 57
BccI CCATC 1 cut(s) 253
BciT130I CCWGG 1 cut(s) 75
BciVI GTATCC 1 cut(s) 39
BcuI ACTAGT 1 cut(s) 296
BfaI CTAG 4 cut(s) 212, 233, 281, 297
BfmI CTRYAG 1 cut(s) 252
BfrI CTTAAG 1 cut(s) 217
BfuI GTATCC 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 75
BmeT110I CYCGRG 1 cut(s) 57
BmrFI CCNGG 1 cut(s) 75
Bse3DI GCAATG 1 cut(s) 108
BseBI CCWGG 1 cut(s) 75
BseMI GCAATG 1 cut(s) 108
BsgI GTGCAG 1 cut(s) 329
BsiHKCI CYCGRG 1 cut(s) 57
BsoBI CYCGRG 1 cut(s) 57
BspTI CTTAAG 1 cut(s) 217
BsrDI GCAATG 1 cut(s) 108
Bst2UI CCWGG 1 cut(s) 75
BstAFI CTTAAG 1 cut(s) 217
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 73
BstSFI CTRYAG 1 cut(s) 252
BsuI GTATCC 1 cut(s) 39
CaiI CAGNNNCTG 1 cut(s) 136
Csp6I GTAC 1 cut(s) 352
CviJI RGCY 3 cut(s) 90, 202, 216
CviKI_1 RGCY 3 cut(s) 90, 202, 216
CviQI GTAC 1 cut(s) 352
Eco57I CTGAAG 1 cut(s) 353
Eco88I CYCGRG 1 cut(s) 57
EcoRII CCWGG 1 cut(s) 73
FaiI YATR 4 cut(s) 185, 229, 254, 294
FspBI CTAG 4 cut(s) 212, 233, 281, 297
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 1 cut(s) 164
Hpy188III TCNNGA 3 cut(s) 59, 143, 281
Hpy8I GTNNAC 1 cut(s) 225
HpyAV CCTTC 2 cut(s) 56, 350
HpyCH4V TGCA 3 cut(s) 16, 102, 346
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 5 cut(s) 60, 87, 99, 122, 362
MaeI CTAG 4 cut(s) 212, 233, 281, 297
MboII GAAGA 1 cut(s) 346
MluCI AATT 6 cut(s) 170, 191, 259, 284, 321, 364
MnlI CCTC 3 cut(s) 73, 177, 229
MseI TTAA 2 cut(s) 194, 218
MspCI CTTAAG 1 cut(s) 217
MspR9I CCNGG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 75
PaeR7I CTCGAG 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
PstNI CAGNNNCTG 1 cut(s) 136
RsaI GTAC 1 cut(s) 353
RsaNI GTAC 1 cut(s) 352
SaqAI TTAA 2 cut(s) 194, 218
ScrFI CCNGG 1 cut(s) 75
SetI ASST 7 cut(s) 169, 190, 204, 224, 234, 342, 351
SfcI CTRYAG 1 cut(s) 252
Sfr274I CTCGAG 1 cut(s) 57
SlaI CTCGAG 1 cut(s) 57
SmlI CTYRAG 2 cut(s) 57, 217
SmoI CTYRAG 2 cut(s) 57, 217
SpeI ACTAGT 1 cut(s) 296
Sse9I AATT 6 cut(s) 170, 191, 259, 284, 321, 364
SspMI CTAG 4 cut(s) 212, 233, 281, 297
StyD4I CCNGG 1 cut(s) 73
TaqI TCGA 2 cut(s) 58, 356
TasI AATT 6 cut(s) 170, 191, 259, 284, 321, 364
TatI WGTACW 1 cut(s) 351
Tru1I TTAA 2 cut(s) 194, 218
Tru9I TTAA 2 cut(s) 194, 218
Vha464I CTTAAG 1 cut(s) 217
XbaI TCTAGA 1 cut(s) 280
XhoI CTCGAG 1 cut(s) 57
XspI CTAG 4 cut(s) 212, 233, 281, 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.