Rmu_sc0014329.1_g000001

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014329.1
Physical Location & Seq
Reverse (-)
1 .. 1481
1481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014329.1_g000001.1.cds

Sequence Viewer

Length: 958 bp
atggccattgcaattatcatcgatttgatctatggtcttgttcttatttacttcctttacatggtcgcaagtgaatttgctttcagattctccaagagaaagtataagttgattaaaagagaatggagattactgggtgctctattagaggattgcaatgaagttacaagatctgggattcaaattacccagaaagccagtacactcttggattcaggacctgtccaagctggattaactatacaactgaatgataaggaaaccggttggataacgaatgcaagaaaagtgatcactggagcagacgagttccaaagttcgaagtctgcaggacaatcttatgctgatgaacttgaatgtacatctgtcaattctgagccaccaacagcccaaattggcttgagaattgatcctgagttgatcattaatttcctctgtcactgtgatgaacttgaatgtacatctgtcaattctgagccaccaacagcccaaattggcttgagaattgatcctgagttgatcatttcctctgtcactgaaaaaccagaagttaaatccttcataatgcatttgcagctactgcaggctttcatgaaagatttgcgaaggctcaaagtactggaaagtaagagggaggagtcctgggtgatagcagcaaacaagacccttgaaaaggcaaaggcaggatctctggcctgctggaaaaaaagatatggttttaaatttgtcaaacgagactcatcattgaaatataatgtacaccatgcttctcaacggaaaagcaatcaatatcagatcacagatgataaggatctctctgatttaaacaacattcggaactggctcattcaactgccaaaaacaagcaataaggtgggatctcatgtcagctcattgagcaaggagctggagcacatgcctaagctgttggaagatacaaaagcaactgaagaaaatg

Protein Analysis

319

Amino Acids

36.17

Weight (kDa)

8.1

Isoelectric Point (pI)

49.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000657)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g34770
malus_domestica MD17G1025700.v1.1
prunus_persica Prupe.3G040600_v2.0.a1 Prupe.3G040800_v2.0.a1 Prupe.3G041000_v2.0.a1 Prupe.3G041100_v2.0.a1 Prupe.3G041500_v2.0.a1 Prupe.4G109400_v2.0.a1 Prupe.8G037400_v2.0.a1 Prupe.8G037400_v2.0.a1 Prupe.8G037700_v2.0.a1
pyrus_communis pycom09g10040 pycom17g16000
rosa_chinensis RchiOBHm_Chr2g0145591 RchiOBHm_Chr2g0145611
rosa_laevigata RLG00000020146 RLG00000020149 RLG00000020151 RLG00000020154
rosa_multiflora Rmu_co7986250.1_g000001 Rmu_co8305779.1_g000001 Rmu_sc0002718.1_g000011 Rmu_sc0002835.1_g000009 Rmu_sc0002835.1_g000016 Rmu_sc0003046.1_g000007 Rmu_sc0003046.1_g000010 Rmu_sc0004445.1_g000006 Rmu_sc0004810.1_g000002 Rmu_sc0006477.1_g000008 Rmu_sc0014329.1_g000001 Rmu_sc0020976.1_g000003 Rmu_sc0021168.1_g000001 Rmu_sc0022199.1_g000001 Rmu_sc0036991.1_g000001 Rmu_sc0041497.1_g000003
rosa_roxburghii Rroxscaffold_152G00434560 Rroxscaffold_152G00434570 Rroxscaffold_152G00434600 Rroxscaffold_152G00434610 Rroxscaffold_2G00100630 Rroxscaffold_2G00100640 Rroxscaffold_2G00100660 Rroxscaffold_2G00100670 Rroxscaffold_2G00100680 Rroxscaffold_2G00100690
rosa_rugosa Rorug02G0392300 Rorug02G0392400 Rorug02G0392400
rosa_samantha Rh2AG445700 Rh2AG445800 Rh2AG446000 Rh2AG446100 Rh2AG446300 Rh2AG446600 Rh2BG457400 Rh2BG457500 Rh2BG457600 Rh2BG457900 Rh2BG458300 Rh2CG432300 Rh2CG432400 Rh2CG432500 Rh2CG432700 Rh2CG432900 Rh2CG433000 Rh2CG433300 Rh2DG467100 Rh2DG467200 Rh2DG467300 Rh2DG467600 Rh2DG467900 Rh3DG194100
rosa_wichuraiana Rw2G036420 Rw2G036450 Rw2G036470 Rw3G014900 Rw3G014920

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 404, 503, 694, 819, 886
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 74, 722
AfaI GTAC 5 cut(s) 202, 361, 460, 618, 759
AfiI CCNNNNNNNGG 2 cut(s) 61, 673
AgeI ACCGGT 1 cut(s) 263
AgsI TTSAA 6 cut(s) 182, 356, 455, 671, 748, 851
AjnI CCWGG 1 cut(s) 641
AluBI AGCT 5 cut(s) 230, 577, 891, 907, 925
AluI AGCT 5 cut(s) 230, 577, 891, 907, 925
Alw21I GWGCWC 2 cut(s) 142, 915
Alw26I GTCTC 1 cut(s) 729
AlwI GGATC 5 cut(s) 404, 503, 694, 819, 886
AlwNI CAGNNNCTG 2 cut(s) 221, 580
AoxI GGCC 2 cut(s) 3, 693
ApeKI GCWGC 2 cut(s) 574, 653
ApoI RAATTY 2 cut(s) 74, 722
AseI ATTAAT 1 cut(s) 426
AsiGI ACCGGT 1 cut(s) 263
AspS9I GGNCC 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 658
AsuII TTCGAA 1 cut(s) 320
AvaII GGWCC 1 cut(s) 218
BalI TGGCCA 1 cut(s) 5
Bbv12I GWGCWC 2 cut(s) 142, 915
BbvI GCAGC 2 cut(s) 586, 665
BciT130I CCWGG 1 cut(s) 643
BclI TGATCA 3 cut(s) 291, 420, 519
BcoDI GTCTC 1 cut(s) 729
BfmI CTRYAG 2 cut(s) 327, 581
BglII AGATCT 1 cut(s) 170
BisI GCNGC 2 cut(s) 575, 654
BlsI GCNGC 2 cut(s) 576, 655
BmcAI AGTACT 1 cut(s) 618
Bme1390I CCNGG 1 cut(s) 643
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 1 cut(s) 218
BmrFI CCNGG 1 cut(s) 643
BmrI ACTGGG 1 cut(s) 143
BmuI ACTGGG 1 cut(s) 143
BpmI CTGGAG 2 cut(s) 318, 929
Bpu10I CCTNAGC 1 cut(s) 921
Bpu14I TTCGAA 1 cut(s) 320
BpuEI CTTGAG 2 cut(s) 421, 520
Bsa29I ATCGAT 1 cut(s) 21
BsaBI GATNNNNATC 1 cut(s) 810
BsaJI CCNNGG 1 cut(s) 642
BsaWI WCCGGW 1 cut(s) 263
Bsc4I CCNNNNNNNGG 2 cut(s) 61, 673
Bse118I RCCGGY 1 cut(s) 263
Bse1I ACTGG 5 cut(s) 138, 198, 301, 624, 845
Bse3DI GCAATG 2 cut(s) 6, 163
Bse8I GATNNNNATC 1 cut(s) 810
BseBI CCWGG 1 cut(s) 643
BseCI ATCGAT 1 cut(s) 21
BseDI CCNNGG 1 cut(s) 642
BseJI GATNNNNATC 1 cut(s) 810
BseLI CCNNNNNNNGG 2 cut(s) 61, 673
BseMI GCAATG 2 cut(s) 6, 163
BseMII CTCAG 4 cut(s) 366, 405, 465, 504
BseNI ACTGG 5 cut(s) 138, 198, 301, 624, 845
BseRI GAGGAG 1 cut(s) 650
BseXI GCAGC 2 cut(s) 586, 665
BshFI GGCC 2 cut(s) 5, 695
BshTI ACCGGT 1 cut(s) 263
BshVI ATCGAT 1 cut(s) 21
BsiHKAI GWGCWC 2 cut(s) 142, 915
BsiSI CCGG 1 cut(s) 264
BslI CCNNNNNNNGG 2 cut(s) 61, 673
BsmAI GTCTC 1 cut(s) 729
BsmI GAATGC 1 cut(s) 283
BsnI GGCC 2 cut(s) 5, 695
Bsp119I TTCGAA 1 cut(s) 320
Bsp1286I GDGCHC 2 cut(s) 142, 915
Bsp1407I TGTACA 3 cut(s) 359, 458, 757
BspANI GGCC 2 cut(s) 5, 695
BspCNI CTCAG 4 cut(s) 367, 406, 466, 505
BspDI ATCGAT 1 cut(s) 21
BspHI TCATGA 1 cut(s) 591
BspMAI CTGCAG 2 cut(s) 331, 585
BspPI GGATC 5 cut(s) 404, 503, 694, 819, 886
BspT104I TTCGAA 1 cut(s) 320
BsrDI GCAATG 2 cut(s) 6, 163
BsrFI RCCGGY 1 cut(s) 263
BsrGI TGTACA 3 cut(s) 359, 458, 757
BsrI ACTGG 5 cut(s) 138, 198, 301, 624, 845
BssAI RCCGGY 1 cut(s) 263
BssECI CCNNGG 1 cut(s) 642
Bst2UI CCWGG 1 cut(s) 643
Bst4CI ACNGT 1 cut(s) 443
BstAPI GCANNNNNTGC 1 cut(s) 580
BstAUI TGTACA 3 cut(s) 359, 458, 757
BstBI TTCGAA 1 cut(s) 320
BstC8I GCNNGC 2 cut(s) 585, 697
BstDEI CTNAG 5 cut(s) 375, 414, 474, 513, 921
BstENI CCTNNNNNAGG 1 cut(s) 671
BstMAI GTCTC 1 cut(s) 729
BstMWI GCNNNNNNNGC 3 cut(s) 574, 580, 897
BstNI CCWGG 1 cut(s) 643
BstNSI RCATGY 1 cut(s) 919
BstSCI CCNGG 1 cut(s) 641
BstSFI CTRYAG 2 cut(s) 327, 581
BstV1I GCAGC 2 cut(s) 586, 665
BstX2I RGATCY 4 cut(s) 170, 686, 811, 878
BstYI RGATCY 4 cut(s) 170, 686, 811, 878
Bsu15I ATCGAT 1 cut(s) 21
BsuRI GGCC 2 cut(s) 5, 695
BsuTUI ATCGAT 1 cut(s) 21
BtsIMutI CAGTG 3 cut(s) 294, 439, 534
Cac8I GCNNGC 2 cut(s) 585, 697
CaiI CAGNNNCTG 2 cut(s) 221, 580
CciI TCATGA 1 cut(s) 591
Cfr10I RCCGGY 1 cut(s) 263
Cfr13I GGNCC 1 cut(s) 218
ClaI ATCGAT 1 cut(s) 21
Csp6I GTAC 5 cut(s) 201, 360, 459, 617, 758
CspAI ACCGGT 1 cut(s) 263
CviAII CATG 5 cut(s) 61, 592, 764, 884, 916
CviQI GTAC 5 cut(s) 201, 360, 459, 617, 758
DdeI CTNAG 5 cut(s) 375, 414, 474, 513, 921
DraI TTTAAA 2 cut(s) 721, 825
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 218
EcoNI CCTNNNNNAGG 1 cut(s) 671
EcoO109I RGGNCCY 1 cut(s) 218
EcoRII CCWGG 1 cut(s) 641
EcoT22I ATGCAT 1 cut(s) 570
FaeI CATG 5 cut(s) 64, 595, 767, 887, 919
FatI CATG 5 cut(s) 60, 591, 763, 883, 915
FbaI TGATCA 3 cut(s) 291, 420, 519
Fnu4HI GCNGC 2 cut(s) 575, 654
Fsp4HI GCNGC 2 cut(s) 575, 654
GluI GCNGC 2 cut(s) 575, 654
GsuI CTGGAG 2 cut(s) 318, 929
HaeIII GGCC 2 cut(s) 5, 695
HapII CCGG 1 cut(s) 264
Hin1II CATG 5 cut(s) 64, 595, 767, 887, 919
HinfI GANTC 5 cut(s) 87, 178, 212, 638, 737
HpaII CCGG 1 cut(s) 264
HphI GGTGA 1 cut(s) 658
Hpy166II GTNNAC 2 cut(s) 203, 760
Hpy188I TCNGA 6 cut(s) 86, 376, 475, 795, 820, 837
Hpy188III TCNNGA 4 cut(s) 216, 413, 512, 592
Hpy8I GTNNAC 2 cut(s) 203, 760
HpyAV CCTTC 2 cut(s) 568, 600
HpyCH4III ACNGT 1 cut(s) 443
HpyCH4V TGCA 7 cut(s) 11, 156, 281, 329, 568, 574, 583
HpyF10VI GCNNNNNNNGC 3 cut(s) 574, 580, 897
HpyF3I CTNAG 5 cut(s) 375, 414, 474, 513, 921
Hsp92II CATG 5 cut(s) 64, 595, 767, 887, 919
Ksp22I TGATCA 3 cut(s) 291, 420, 519
LmnI GCTCC 3 cut(s) 299, 904, 910
Lsp1109I GCAGC 2 cut(s) 586, 665
MaeIII GTNAC 3 cut(s) 163, 437, 532
MboII GAAGA 1 cut(s) 944
MflI RGATCY 4 cut(s) 170, 686, 811, 878
MhlI GDGCHC 2 cut(s) 142, 915
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 2 cut(s) 647, 731
MmeI TCCRAC 2 cut(s) 248, 909
MnlI CCTC 5 cut(s) 142, 443, 538, 624, 628
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 1 cut(s) 570
MscI TGGCCA 1 cut(s) 5
MseI TTAA 6 cut(s) 114, 236, 426, 552, 720, 824
MslI CAYNNNNRTG 1 cut(s) 444
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 1 cut(s) 264
MspR9I CCNGG 1 cut(s) 643
Mva1269I GAATGC 1 cut(s) 283
MvaI CCWGG 1 cut(s) 643
MwoI GCNNNNNNNGC 3 cut(s) 574, 580, 897
NlaIII CATG 5 cut(s) 64, 595, 767, 887, 919
NmuCI GTSAC 2 cut(s) 437, 532
NsiI ATGCAT 1 cut(s) 570
NspI RCATGY 1 cut(s) 919
NspV TTCGAA 1 cut(s) 320
PagI TCATGA 1 cut(s) 591
PctI GAATGC 1 cut(s) 283
PfeI GAWTC 3 cut(s) 87, 178, 212
PinAI ACCGGT 1 cut(s) 263
PkrI GCNGC 2 cut(s) 576, 655
PleI GAGTC 2 cut(s) 646, 731
PpsI GAGTC 2 cut(s) 646, 731
PpuMI RGGWCCY 1 cut(s) 218
PshBI ATTAAT 1 cut(s) 426
Psp5II RGGWCCY 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 641
PspGI CCWGG 1 cut(s) 641
PspPI GGNCC 1 cut(s) 218
PspPPI RGGWCCY 1 cut(s) 218
PstI CTGCAG 2 cut(s) 331, 585
PstNI CAGNNNCTG 2 cut(s) 221, 580
PsuI RGATCY 4 cut(s) 170, 686, 811, 878
RsaI GTAC 5 cut(s) 202, 361, 460, 618, 759
RsaNI GTAC 5 cut(s) 201, 360, 459, 617, 758
RseI CAYNNNNRTG 1 cut(s) 444
SaqAI TTAA 6 cut(s) 114, 236, 426, 552, 720, 824
SatI GCNGC 2 cut(s) 575, 654
Sau96I GGNCC 1 cut(s) 218
ScaI AGTACT 1 cut(s) 618
SchI GAGTC 2 cut(s) 647, 731
ScrFI CCNGG 1 cut(s) 643
SduI GDGCHC 2 cut(s) 142, 915
SetI ASST 7 cut(s) 223, 232, 579, 876, 893, 909, 927
SfcI CTRYAG 2 cut(s) 327, 581
SfuI TTCGAA 1 cut(s) 320
SinI GGWCC 1 cut(s) 218
SmiMI CAYNNNNRTG 1 cut(s) 444
SmlI CTYRAG 2 cut(s) 400, 499
SmoI CTYRAG 2 cut(s) 400, 499
StyD4I CCNGG 1 cut(s) 641
TaaI ACNGT 1 cut(s) 443
TaqI TCGA 2 cut(s) 21, 320
TatI WGTACW 5 cut(s) 200, 359, 458, 616, 757
TfiI GAWTC 3 cut(s) 87, 178, 212
Tru1I TTAA 6 cut(s) 114, 236, 426, 552, 720, 824
Tru9I TTAA 6 cut(s) 114, 236, 426, 552, 720, 824
TscAI CASTG 3 cut(s) 301, 446, 541
TseFI GTSAC 2 cut(s) 437, 532
TseI GCWGC 2 cut(s) 574, 653
Tsp45I GTSAC 2 cut(s) 437, 532
TspDTI ATGAA 6 cut(s) 174, 363, 462, 550, 580, 608
TspGWI ACGGA 1 cut(s) 790
TspRI CASTG 3 cut(s) 301, 446, 541
VpaK11BI GGWCC 1 cut(s) 218
VspI ATTAAT 1 cut(s) 426
XagI CCTNNNNNAGG 1 cut(s) 671
XapI RAATTY 2 cut(s) 74, 722
XceI RCATGY 1 cut(s) 919
XcmI CCANNNNNNNNNTGG 1 cut(s) 205
ZrmI AGTACT 1 cut(s) 618
Zsp2I ATGCAT 1 cut(s) 570
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.