Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000516.1

Orthogroup ID

OG0000916

Physical Location & Seq

Genomic Coordinates Forward (+)

101479 .. 102370

Gene Structure 892 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000516.1_g000026.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 687 bp

atgttgcctaattcaactcccatagcagtgaatcaactaaagagtctgttgcaagctgaaaagcaatttcaggctgaagcgagaactcttggtgcaatccaacacattaatcttcttcgcctctgtgggttttgtgcaaattctacaagaagactcttagtttatgactacgtgcccaatggctctctacaatctattctagttcaaaaccatccactaatcttagattcgaaagcaagatatcaaattgccataggcattgcaagaggattggcttacctccatgaggactgtagagattgtataatacactgtgacattaagccagagaacatttgttggatgaagaatatagtgaagccatcactccaaaagcagatgtcttcagctatggaaagtttctgtttgaggttatatctagaaggagaaacagtgaagggaggtaatgctgacaaagatgaactcattagagcatgcaaagtcgcgtgttggtgtattcaagatgaggagaaggatatgccaataatgaggcaggttgttcaaattctcgaaggagctttagatgttggtatacctccgatcccacagtttcttcagcaccttcccgaagttcaatggaagcaatcaattaccgagaacctacctctagttcagaaatcatattccttagctgatcagtggctttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin PAN_2 Pkinase S_locus_glycop

Protein Analysis

228

Amino Acids

25.83

Weight (kDa)

6.51

Isoelectric Point (pI)

54.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000916)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g26420 FvH4_6g26420 FvH4_6g26450 FvH4_6g26451
malus_domestica	MD09G1116700.v1.1 MD09G1233200.v1.1 MD12G1033500.v1.1 MD14G1034400.v1.1 MD14G1034600.v1.1 MD14G1034700.v1.1 MD14G1034800.v1.1 MD14G1034900.v1.1 MD14G1035200.v1.1 MD17G1090300.v1.1 MD17G1108200.v1.1 MD17G1237700.v1.1 MD17G1237800.v1.1 MD17G1238000.v1.1 MD17G1238400.v1.1
prunus_persica	Prupe.3G131100_v2.0.a1 Prupe.3G141400_v2.0.a1
pyrus_communis	pycom09g04120 pycom12g03080 pycom14g03020 pycom14g03080 pycom14g03090 pycom17g24250
rosa_chinensis	RchiOBHm_Chr2g0127791 RchiOBHm_Chr2g0127811 RchiOBHm_Chr2g0127821 RchiOBHm_Chr2g0128001
rosa_laevigata	RLG00000002113 RLG00000018931 RLG00000018932 RLG00000018933 RLG00000018934 RLG00000023426
rosa_multiflora	Rmu_sc0000516.1_g000026 Rmu_sc0000516.1_g000045 Rmu_ssc0000093.1_g000010 Rmu_ssc0000093.1_g000016 Rmu_ssc0000093.1_g000017 Rmu_ssc0000093.1_g000024
rosa_roxburghii	Rroxscaffold_2G00116790 Rroxscaffold_2G00116800 Rroxscaffold_2G00116810 Rroxscaffold_2G00116840
rosa_rugosa	Rorug02G0270500 Rorug02G0270600 Rorug02G0270800 Rorug02G0270900 Rorug02G0271000
rosa_samantha	Rh2AG323100 Rh2BG332100 Rh2BG332200 Rh2BG332300 Rh2CG310900 Rh2CG311000 Rh2DG350400 Rh2DG350500 Rh2DG350600 Rh2DG350700
rosa_wichuraiana	Rw2G026190 Rw2G026210 Rw2G026230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	523
AccI	GTMKAC	1 cut(s)	571
AccII	CGCG	1 cut(s)	485
AclWI	GGATC	1 cut(s)	574
AcsI	RAATTY	2 cut(s)	139, 543
AcuI	CTGAAG	3 cut(s)	96, 369, 578
AfiI	CCNNNNNNNGG	1 cut(s)	286
AgsI	TTSAA	5 cut(s)	15, 206, 500, 542, 614
AluBI	AGCT	4 cut(s)	56, 389, 557, 671
AluI	AGCT	4 cut(s)	56, 389, 557, 671
AlwI	GGATC	1 cut(s)	574
ApoI	RAATTY	2 cut(s)	139, 543
AseI	ATTAAT	1 cut(s)	108
AsuII	TTCGAA	1 cut(s)	230
BaeGI	GKGCMC	1 cut(s)	177
BbsI	GAAGAC	2 cut(s)	157, 375
BccI	CCATC	2 cut(s)	219, 370
BclI	TGATCA	1 cut(s)	673
BfaI	CTAG	3 cut(s)	200, 419, 647
BfmI	CTRYAG	1 cut(s)	292
BfuAI	ACCTGC	1 cut(s)	523
BpiI	GAAGAC	2 cut(s)	157, 375
Bpu10I	CCTNAGC	1 cut(s)	667
Bpu14I	TTCGAA	1 cut(s)	230
BsaAI	YACGTR	1 cut(s)	172
BsaXI	ACNNNNNCTCC	2 cut(s)	417, 447
Bsc4I	CCNNNNNNNGG	1 cut(s)	286
Bse3DI	GCAATG	1 cut(s)	258
BseGI	GGATG	2 cut(s)	211, 348
BseLI	CCNNNNNNNGG	1 cut(s)	286
BseMI	GCAATG	1 cut(s)	258
BseRI	GAGGAG	1 cut(s)	521
BseSI	GKGCMC	1 cut(s)	177
Bsh1236I	CGCG	1 cut(s)	485
BslI	CCNNNNNNNGG	1 cut(s)	286
Bsp119I	TTCGAA	1 cut(s)	230
Bsp1286I	GDGCHC	1 cut(s)	177
Bsp143I	GATC	2 cut(s)	579, 673
BspFNI	CGCG	1 cut(s)	485
BspMI	ACCTGC	1 cut(s)	523
BspPI	GGATC	1 cut(s)	574
BspT104I	TTCGAA	1 cut(s)	230
BsrDI	GCAATG	1 cut(s)	258
BssMI	GATC	2 cut(s)	579, 673
BssNAI	GTATAC	1 cut(s)	572
Bst1107I	GTATAC	1 cut(s)	572
Bst4CI	ACNGT	4 cut(s)	293, 314, 433, 588
BstBAI	YACGTR	1 cut(s)	172
BstBI	TTCGAA	1 cut(s)	230
BstC8I	GCNNGC	2 cut(s)	54, 475
BstDEI	CTNAG	3 cut(s)	157, 223, 667
BstENI	CCTNNNNNAGG	1 cut(s)	284
BstF5I	GGATG	2 cut(s)	211, 348
BstFNI	CGCG	1 cut(s)	485
BstKTI	GATC	2 cut(s)	582, 676
BstMBI	GATC	2 cut(s)	579, 673
BstNSI	RCATGY	1 cut(s)	477
BstSFI	CTRYAG	1 cut(s)	292
BstSLI	GKGCMC	1 cut(s)	177
BstUI	CGCG	1 cut(s)	485
BstV2I	GAAGAC	2 cut(s)	157, 375
BstZ17I	GTATAC	1 cut(s)	572
BtsCI	GGATG	2 cut(s)	211, 348
BtsI	GCAGTG	1 cut(s)	33
BtsIMutI	CAGTG	4 cut(s)	33, 310, 438, 683
BveI	ACCTGC	1 cut(s)	523
Cac8I	GCNNGC	2 cut(s)	54, 475
CviAII	CATG	2 cut(s)	284, 474
DdeI	CTNAG	3 cut(s)	157, 223, 667
DpnI	GATC	2 cut(s)	581, 675
DpnII	GATC	2 cut(s)	579, 673
Eco32I	GATATC	1 cut(s)	242
Eco57I	CTGAAG	3 cut(s)	96, 369, 578
EcoNI	CCTNNNNNAGG	1 cut(s)	284
EcoRV	GATATC	1 cut(s)	242
FaeI	CATG	2 cut(s)	287, 477
FatI	CATG	2 cut(s)	283, 473
FbaI	TGATCA	1 cut(s)	673
FblI	GTMKAC	1 cut(s)	571
FokI	GGATG	2 cut(s)	198, 355
FspBI	CTAG	3 cut(s)	200, 419, 647
Hin1II	CATG	2 cut(s)	287, 477
HinfI	GANTC	4 cut(s)	31, 43, 153, 227
Hpy166II	GTNNAC	1 cut(s)	572
Hpy188I	TCNGA	2 cut(s)	579, 654
Hpy188III	TCNNGA	4 cut(s)	419, 500, 548, 605
Hpy8I	GTNNAC	1 cut(s)	572
HpyAV	CCTTC	5 cut(s)	416, 430, 505, 545, 611
HpyCH4III	ACNGT	4 cut(s)	293, 314, 433, 588
HpyCH4IV	ACGT	1 cut(s)	171
HpyCH4V	TGCA	5 cut(s)	52, 95, 137, 263, 477
HpyF3I	CTNAG	3 cut(s)	157, 223, 667
HpySE526I	ACGT	1 cut(s)	171
Hsp92II	CATG	2 cut(s)	287, 477
Ksp22I	TGATCA	1 cut(s)	673
Kzo9I	GATC	2 cut(s)	579, 673
LmnI	GCTCC	1 cut(s)	554
LpnPI	CCDG	3 cut(s)	56, 339, 518
MaeI	CTAG	3 cut(s)	200, 419, 647
MaeII	ACGT	1 cut(s)	171
MaeIII	GTNAC	1 cut(s)	314
MalI	GATC	2 cut(s)	581, 675
MboI	GATC	2 cut(s)	579, 673
MboII	GAAGA	6 cut(s)	104, 107, 162, 358, 375, 584
MhlI	GDGCHC	1 cut(s)	177
MluCI	AATT	6 cut(s)	10, 65, 139, 246, 543, 627
MlyI	GAGTC	2 cut(s)	52, 147
MmeI	TCCRAC	2 cut(s)	124, 320
MseI	TTAA	2 cut(s)	108, 321
MslI	CAYNNNNRTG	1 cut(s)	26
MvnI	CGCG	1 cut(s)	485
NdeII	GATC	2 cut(s)	579, 673
NlaIII	CATG	2 cut(s)	287, 477
NmuCI	GTSAC	1 cut(s)	314
NspI	RCATGY	1 cut(s)	477
NspV	TTCGAA	1 cut(s)	230
PaeI	GCATGC	1 cut(s)	477
PfeI	GAWTC	2 cut(s)	31, 227
PleI	GAGTC	2 cut(s)	51, 147
PpsI	GAGTC	2 cut(s)	51, 147
Ppu21I	YACGTR	1 cut(s)	172
PshBI	ATTAAT	1 cut(s)	108
RseI	CAYNNNNRTG	1 cut(s)	26
SaqAI	TTAA	2 cut(s)	108, 321
Sau3AI	GATC	2 cut(s)	579, 673
SchI	GAGTC	2 cut(s)	52, 147
SduI	GDGCHC	1 cut(s)	177
SfcI	CTRYAG	1 cut(s)	292
SfuI	TTCGAA	1 cut(s)	230
SmiMI	CAYNNNNRTG	1 cut(s)	26
SphI	GCATGC	1 cut(s)	477
Sse9I	AATT	6 cut(s)	10, 65, 139, 246, 543, 627
SspMI	CTAG	3 cut(s)	200, 419, 647
TaaI	ACNGT	4 cut(s)	293, 314, 433, 588
TaiI	ACGT	1 cut(s)	174
TaqI	TCGA	2 cut(s)	230, 549
TasI	AATT	6 cut(s)	10, 65, 139, 246, 543, 627
TfiI	GAWTC	2 cut(s)	31, 227
Tru1I	TTAA	2 cut(s)	108, 321
Tru9I	TTAA	2 cut(s)	108, 321
TscAI	CASTG	4 cut(s)	33, 317, 438, 683
TseFI	GTSAC	1 cut(s)	314
Tsp45I	GTSAC	1 cut(s)	314
TspDTI	ATGAA	2 cut(s)	359, 474
TspRI	CASTG	4 cut(s)	33, 317, 438, 683
VspI	ATTAAT	1 cut(s)	108
XagI	CCTNNNNNAGG	1 cut(s)	284
XapI	RAATTY	2 cut(s)	139, 543
XbaI	TCTAGA	1 cut(s)	418
XceI	RCATGY	1 cut(s)	477
XmiI	GTMKAC	1 cut(s)	571
XspI	CTAG	3 cut(s)	200, 419, 647

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.