Rh2DG350500

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
49083085 .. 49086495
3411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG350500.1

Sequence Viewer

Length: 504 bp
ATGGGGTCTGGCAGTCTCTCACCAGGCCAATTTCTTCTTGTACACCAAGAAATTACTTCTCCAAGAGGCATGTTTGAGCTAGGTTTCTTCACACCAGGTAACTCTCAAAACTATTACATAGGCATCTGGTACAAAAATGTACCCAATCAAATAGTTGTTTGGGTGGCAAACAGAAACCAACCGATTATTGATCCAAATTCCTCATCATTTGTACTCCTTGAAAATGGAAACTTGACCTTAAATAGCCCCTCAATGGTGGCAATATGGTCAACTAATTCAACATCAAAGGGTAAAAATTCTACCATAGCCATGCTTCTTGACAATGGAAACTTTGTCATAAGAGATGCATTTGATTCGTCTGATGTTATATGGCAAAGTTTCGACCACCCAACAGATACTTGGCTGCCAGGTTGGGAGGTAATGTTGACAAACAGGAACTCAATAGAGCATGCAAAGTCGCGTGTTGGTGCATTCAAGATGATGAGAAGGATAGACCAAGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

167

Amino Acids

18.76

Weight (kDa)

6.26

Isoelectric Point (pI)

31.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 52 - 148 3.7e-29 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 460
AclWI GGATC 1 cut(s) 185
AcsI RAATTY 2 cut(s) 196, 295
AfaI GTAC 4 cut(s) 42, 131, 141, 213
AfiI CCNNNNNNNGG 1 cut(s) 253
AgsI TTSAA 3 cut(s) 221, 279, 475
AjnI CCWGG 3 cut(s) 22, 94, 406
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
Alw26I GTCTC 1 cut(s) 20
AlwI GGATC 1 cut(s) 185
AoxI GGCC 1 cut(s) 25
ApeKI GCWGC 1 cut(s) 403
ApoI RAATTY 2 cut(s) 196, 295
AsuHPI GGTGA 1 cut(s) 12
BbvI GCAGC 1 cut(s) 390
BcgI CGANNNNNNTGC 2 cut(s) 336, 370
BciT130I CCWGG 3 cut(s) 24, 96, 408
BcoDI GTCTC 1 cut(s) 20
BfaI CTAG 1 cut(s) 80
BisI GCNGC 1 cut(s) 404
BlsI GCNGC 1 cut(s) 405
Bme1390I CCNGG 3 cut(s) 24, 96, 408
BmrFI CCNGG 3 cut(s) 24, 96, 408
BmsI GCATC 2 cut(s) 132, 334
BsaXI ACNNNNNCTCC 2 cut(s) 407, 437
Bsc4I CCNNNNNNNGG 1 cut(s) 253
BseBI CCWGG 3 cut(s) 24, 96, 408
BseLI CCNNNNNNNGG 1 cut(s) 253
BseXI GCAGC 1 cut(s) 390
Bsh1236I CGCG 1 cut(s) 460
BshFI GGCC 1 cut(s) 27
BslI CCNNNNNNNGG 1 cut(s) 253
BsmAI GTCTC 1 cut(s) 20
BsmI GAATGC 1 cut(s) 470
BsnI GGCC 1 cut(s) 27
Bsp1407I TGTACA 1 cut(s) 40
Bsp143I GATC 1 cut(s) 190
BspANI GGCC 1 cut(s) 27
BspFNI CGCG 1 cut(s) 460
BspPI GGATC 1 cut(s) 185
BsrGI TGTACA 1 cut(s) 40
BssMI GATC 1 cut(s) 190
Bst2UI CCWGG 3 cut(s) 24, 96, 408
BstAUI TGTACA 1 cut(s) 40
BstC8I GCNNGC 1 cut(s) 450
BstFNI CGCG 1 cut(s) 460
BstKTI GATC 1 cut(s) 193
BstMAI GTCTC 1 cut(s) 20
BstMBI GATC 1 cut(s) 190
BstNI CCWGG 3 cut(s) 24, 96, 408
BstNSI RCATGY 2 cut(s) 73, 452
BstSCI CCNGG 3 cut(s) 22, 94, 406
BstUI CGCG 1 cut(s) 460
BstV1I GCAGC 1 cut(s) 390
BsuRI GGCC 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 450
CsiI ACCWGGT 1 cut(s) 94
Csp6I GTAC 4 cut(s) 41, 130, 140, 212
CviAII CATG 3 cut(s) 70, 310, 449
CviJI RGCY 5 cut(s) 27, 79, 246, 308, 403
CviKI_1 RGCY 5 cut(s) 27, 79, 246, 308, 403
CviQI GTAC 4 cut(s) 41, 130, 140, 212
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
EcoRII CCWGG 3 cut(s) 22, 94, 406
EcoT22I ATGCAT 1 cut(s) 349
FaeI CATG 3 cut(s) 73, 313, 452
FatI CATG 3 cut(s) 69, 309, 448
Fnu4HI GCNGC 1 cut(s) 404
Fsp4HI GCNGC 1 cut(s) 404
FspBI CTAG 1 cut(s) 80
GluI GCNGC 1 cut(s) 404
HaeIII GGCC 1 cut(s) 27
Hin1II CATG 3 cut(s) 73, 313, 452
HincII GTYRAC 2 cut(s) 270, 426
HindII GTYRAC 2 cut(s) 270, 426
HinfI GANTC 1 cut(s) 353
HphI GGTGA 1 cut(s) 12
Hpy166II GTNNAC 3 cut(s) 43, 270, 426
Hpy188I TCNGA 1 cut(s) 361
Hpy188III TCNNGA 2 cut(s) 317, 475
Hpy8I GTNNAC 3 cut(s) 43, 270, 426
HpyAV CCTTC 1 cut(s) 480
HpyCH4V TGCA 3 cut(s) 347, 452, 470
Hsp92II CATG 3 cut(s) 73, 313, 452
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 8 cut(s) 9, 36, 81, 108, 112, 393, 418, 420
Lsp1109I GCAGC 1 cut(s) 390
LweI GCATC 2 cut(s) 132, 334
MabI ACCWGGT 1 cut(s) 94
MaeI CTAG 1 cut(s) 80
MaeIII GTNAC 1 cut(s) 98
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 2 cut(s) 26, 79
MluCI AATT 5 cut(s) 29, 51, 196, 274, 295
MnlI CCTC 4 cut(s) 59, 211, 259, 409
Mph1103I ATGCAT 1 cut(s) 349
MseI TTAA 1 cut(s) 239
MslI CAYNNNNRTG 1 cut(s) 308
MspR9I CCNGG 3 cut(s) 24, 96, 408
Mva1269I GAATGC 1 cut(s) 470
MvaI CCWGG 3 cut(s) 24, 96, 408
MvnI CGCG 1 cut(s) 460
NdeII GATC 1 cut(s) 190
NlaIII CATG 3 cut(s) 73, 313, 452
NsiI ATGCAT 1 cut(s) 349
NspI RCATGY 2 cut(s) 73, 452
PaeI GCATGC 1 cut(s) 452
PctI GAATGC 1 cut(s) 470
PfeI GAWTC 1 cut(s) 353
PkrI GCNGC 1 cut(s) 405
Psp6I CCWGG 3 cut(s) 22, 94, 406
PspGI CCWGG 3 cut(s) 22, 94, 406
RsaI GTAC 4 cut(s) 42, 131, 141, 213
RsaNI GTAC 4 cut(s) 41, 130, 140, 212
RseI CAYNNNNRTG 1 cut(s) 308
SaqAI TTAA 1 cut(s) 239
SatI GCNGC 1 cut(s) 404
Sau3AI GATC 1 cut(s) 190
ScrFI CCNGG 3 cut(s) 24, 96, 408
SetI ASST 6 cut(s) 81, 85, 100, 239, 412, 420
SexAI ACCWGGT 1 cut(s) 94
SfaNI GCATC 2 cut(s) 132, 334
SmiMI CAYNNNNRTG 1 cut(s) 308
SphI GCATGC 1 cut(s) 452
Sse9I AATT 5 cut(s) 29, 51, 196, 274, 295
SspMI CTAG 1 cut(s) 80
StyD4I CCNGG 3 cut(s) 22, 94, 406
TaqI TCGA 1 cut(s) 381
TasI AATT 5 cut(s) 29, 51, 196, 274, 295
TatI WGTACW 2 cut(s) 40, 211
TfiI GAWTC 1 cut(s) 353
Tru1I TTAA 1 cut(s) 239
Tru9I TTAA 1 cut(s) 239
TseI GCWGC 1 cut(s) 403
XapI RAATTY 2 cut(s) 196, 295
XceI RCATGY 2 cut(s) 73, 452
XcmI CCANNNNNNNNNTGG 1 cut(s) 396
XspI CTAG 1 cut(s) 80
Zsp2I ATGCAT 1 cut(s) 349
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.