Rmu_sc0002441.1_g000012
ERF Family

Belongs to the AB hydrolase superfamily. Lipase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002441.1
OG0000706
Physical Location & Seq
Forward (+)
51387 .. 53474
2088 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002441.1_g000012.1.cds

Sequence Viewer

Length: 1053 bp
atggccaagtgcccttcaaaccctctgcttcttgtggctctactttgtgcttttgcagctgcaggaatcaacagtcttgatcaaaatggtatttgcaaatcattggtggagacacaaggctatacttgccaagaccatcaagtaacgacagaagatggttacatcctcggattgcagaggattccatctggacgttccagtaacaattcgaccgctcagaagctgcctgttttattacaacatggacttacgatggatgctgccgcatggctaatcaatcctccagatcaagctttggcgtttatcttagccgacaaggggtttgatgtatggcttgctaatgctcgaggaacgcaggctagccgtggacaccaatcacttagtactaatgatccgacttattgggaatggacatgggatcaattggctgcttatgatcttcctgctttctttaattatgtgaacaatcaaacaggacagaaagtacactatgttggccattcactgggaacattgtcagtattagctgctttgtcacaacaaaagctgagtaacacactaagatcagctgctttacttagcccggttgcttatctgggtcagatcaccacaggactctacgcctctggtatccgcgaatatcctcctcaaggggtagctggacagaacttggtgacatttctctgctcacaaccgggtgtggactgctccaattttatggcggctgtaaccgtgatcaggagaggaacaataacaatgtttgattacaattttccggccattaacatgcaacactacaatcagcttactcctccggtgtacaacatggcaagcatttcgaaagacgttcctcttttctttggctatggagggagagatgcactttcggacgtcaatgatgtgaaggctttgcttaatgaccttagtgatcatgacaaggacaagcttgtggaacaatacgtggaggagtatgctcatatggatttcattatgggtgggaatgccaatcaaaaagtctacgatcctctgctcactttcttcgggcaacattga

Protein Analysis

350

Amino Acids

38.33

Weight (kDa)

5.37

Isoelectric Point (pI)

29.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000706)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g03230 FvH4_5g03471 FvH4_5g03472 FvH4_6g41950 FvH4_6g41951
malus_domestica MD09G1115700.v1.1 MD09G1115900.v1.1 MD17G1107600.v1.1 MD17G1107700.v1.1
prunus_persica Prupe.3G208700_v2.0.a1 Prupe.3G208800_v2.0.a1 Prupe.5G037500_v2.0.a1
pyrus_communis pycom09g04010 pycom09g04030 pycom17g10020 pycom17g10030
rosa_chinensis RchiOBHm_Chr2g0101861 RchiOBHm_Chr2g0157451 RchiOBHm_Chr2g0157461 RchiOBHm_Chr2g0157841 RchiOBHm_Chr2g0157851 RchiOBHm_Chr3g0484721 RchiOBHm_Chr3g0484731 RchiOBHm_Chr3g0484741 RchiOBHm_Chr3g0484751 RchiOBHm_Chr6g0253931 RchiOBHm_Chr6g0253991
rosa_laevigata RLG00000014950 RLG00000014954 RLG00000020989 RLG00000021024 RLG00000021026 RLG00000021027 RLG00000021029 RLG00000021030
rosa_multiflora Rmu_sc0000195.1_g000023 Rmu_sc0000195.1_g000028 Rmu_sc0001689.1_g000007 Rmu_sc0001716.1_g000018 Rmu_sc0002441.1_g000012 Rmu_sc0004191.1_g000065 Rmu_sc0004473.1_g000004
rosa_roxburghii Rroxscaffold_1G00036760 Rroxscaffold_1G00036780 Rroxscaffold_2G00091900 Rroxscaffold_2G00092180 Rroxscaffold_2G00092200 Rroxscaffold_2G00127230 Rroxscaffold_7G00211340 Rroxscaffold_7G00211380
rosa_rugosa Rorug02G0102500 Rorug02G0206400 Rorug02G0206500 Rorug02G0461400 Rorug02G0464100 Rorug05G0548600 Rorug05G0548800
rosa_samantha Rh2BG155500 Rh2BG540100 Rh2BG540200 Rh2BG543500 Rh2BG543700 Rh2BG543800 Rh3CG296800 Rh6AG064700 Rh6AG065300
rosa_wichuraiana Rw2G020570 Rw2G043520 Rw2G043530 Rw2G043770 Rw2G043780 Rw3G023530 Rw3G023540 Rw6G005750

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 894
AccB7I CCANNNNNTGG 1 cut(s) 505
AccBSI CCGCTC 1 cut(s) 215
AccI GTMKAC 1 cut(s) 1017
AccII CGCG 1 cut(s) 636
AciI CCGC 4 cut(s) 213, 264, 634, 722
AclWI GGATC 3 cut(s) 386, 426, 1016
AcoI YGGCCR 3 cut(s) 3, 496, 777
AcyI GRCGYC 1 cut(s) 891
AfaI GTAC 3 cut(s) 385, 486, 821
AfiI CCNNNNNNNGG 4 cut(s) 318, 505, 650, 738
AgsI TTSAA 1 cut(s) 18
AluBI AGCT 9 cut(s) 59, 223, 293, 527, 547, 569, 659, 805, 946
AluI AGCT 9 cut(s) 59, 223, 293, 527, 547, 569, 659, 805, 946
Alw26I GTCTC 1 cut(s) 104
AlwI GGATC 3 cut(s) 386, 426, 1016
AlwNI CAGNNNCTG 1 cut(s) 223
Ama87I CYCGRG 1 cut(s) 345
AoxI GGCC 3 cut(s) 3, 496, 777
ApeKI GCWGC 7 cut(s) 56, 59, 223, 260, 428, 527, 569
ArsI GACNNNNNNTTYG 2 cut(s) 305, 337
AsuC2I CCSGG 2 cut(s) 584, 696
AsuHPI GGTGA 2 cut(s) 598, 685
AsuII TTCGAA 1 cut(s) 839
AsuNHI GCTAGC 1 cut(s) 359
AvaI CYCGRG 1 cut(s) 345
BaeGI GKGCMC 1 cut(s) 14
BalI TGGCCA 2 cut(s) 5, 498
BbvI GCAGC 7 cut(s) 46, 68, 210, 247, 415, 514, 556
BccI CCATC 4 cut(s) 144, 149, 193, 247
BceAI ACGGC 1 cut(s) 348
BcgI CGANNNNNNTGC 2 cut(s) 819, 853
BciVI GTATCC 1 cut(s) 641
BclI TGATCA 3 cut(s) 79, 735, 928
BcnI CCSGG 2 cut(s) 584, 696
BcoDI GTCTC 1 cut(s) 104
BfaI CTAG 1 cut(s) 360
BfmI CTRYAG 1 cut(s) 60
BfuI GTATCC 1 cut(s) 641
BisI GCNGC 9 cut(s) 57, 60, 224, 261, 264, 429, 528, 570, 723
BlsI GCNGC 9 cut(s) 58, 61, 225, 262, 265, 430, 529, 571, 724
BmcAI AGTACT 1 cut(s) 385
Bme1390I CCNGG 2 cut(s) 584, 696
BmeT110I CYCGRG 1 cut(s) 345
BmrFI CCNGG 2 cut(s) 584, 696
BmrI ACTGGG 1 cut(s) 515
BmsI GCATC 2 cut(s) 247, 868
BmtI GCTAGC 1 cut(s) 363
BmuI ACTGGG 1 cut(s) 515
BpmI CTGGAG 1 cut(s) 267
Bpu14I TTCGAA 1 cut(s) 839
BpuEI CTTGAG 1 cut(s) 633
BpuMI CCSGG 2 cut(s) 584, 696
BsaAI YACGTR 1 cut(s) 961
BsaHI GRCGYC 1 cut(s) 891
BsaJI CCNNGG 2 cut(s) 166, 364
BsaWI WCCGGW 1 cut(s) 814
Bsc4I CCNNNNNNNGG 4 cut(s) 318, 505, 650, 738
Bse1I ACTGG 2 cut(s) 198, 510
BseDI CCNNGG 2 cut(s) 166, 364
BseGI GGATG 2 cut(s) 162, 262
BseLI CCNNNNNNNGG 4 cut(s) 318, 505, 650, 738
BseMII CTCAG 2 cut(s) 230, 539
BseNI ACTGG 2 cut(s) 198, 510
BseRI GAGGAG 3 cut(s) 636, 801, 980
BseSI GKGCMC 1 cut(s) 14
BseXI GCAGC 7 cut(s) 46, 68, 210, 247, 415, 514, 556
Bsh1236I CGCG 1 cut(s) 636
Bsh1285I CGRYCG 1 cut(s) 213
BshFI GGCC 3 cut(s) 5, 498, 779
BsiEI CGRYCG 1 cut(s) 213
BsiHKCI CYCGRG 1 cut(s) 345
BsiSI CCGG 4 cut(s) 584, 695, 776, 815
BslI CCNNNNNNNGG 4 cut(s) 318, 505, 650, 738
BsmAI GTCTC 1 cut(s) 104
BsmI GAATGC 1 cut(s) 1006
BsnI GGCC 3 cut(s) 5, 498, 779
BsoBI CYCGRG 1 cut(s) 345
Bsp119I TTCGAA 1 cut(s) 839
Bsp1286I GDGCHC 1 cut(s) 14
Bsp1407I TGTACA 1 cut(s) 819
BspACI CCGC 4 cut(s) 213, 264, 634, 722
BspANI GGCC 3 cut(s) 5, 498, 779
BspCNI CTCAG 2 cut(s) 229, 540
BspFNI CGCG 1 cut(s) 636
BspHI TCATGA 1 cut(s) 931
BspMAI CTGCAG 1 cut(s) 64
BspOI GCTAGC 1 cut(s) 363
BspPI GGATC 3 cut(s) 386, 426, 1016
BspT104I TTCGAA 1 cut(s) 839
BsrBI CCGCTC 1 cut(s) 215
BsrGI TGTACA 1 cut(s) 819
BsrI ACTGG 2 cut(s) 198, 510
BssECI CCNNGG 2 cut(s) 166, 364
BssNI GRCGYC 1 cut(s) 891
Bst4CI ACNGT 2 cut(s) 74, 733
BstACI GRCGYC 1 cut(s) 891
BstAUI TGTACA 1 cut(s) 819
BstBAI YACGTR 1 cut(s) 961
BstBI TTCGAA 1 cut(s) 839
BstC8I GCNNGC 4 cut(s) 336, 357, 361, 832
BstDEI CTNAG 7 cut(s) 216, 307, 380, 548, 560, 578, 923
BstDSI CCRYGG 1 cut(s) 364
BstENI CCTNNNNNAGG 1 cut(s) 648
BstF5I GGATG 2 cut(s) 162, 262
BstFNI CGCG 1 cut(s) 636
BstMAI GTCTC 1 cut(s) 104
BstMCI CGRYCG 1 cut(s) 213
BstMWI GCNNNNNNNGC 2 cut(s) 56, 126
BstNSI RCATGY 1 cut(s) 790
BstSCI CCNGG 2 cut(s) 582, 694
BstSFI CTRYAG 1 cut(s) 60
BstSLI GKGCMC 1 cut(s) 14
BstUI CGCG 1 cut(s) 636
BstV1I GCAGC 7 cut(s) 46, 68, 210, 247, 415, 514, 556
BstXI CCANNNNNNTGG 1 cut(s) 718
BsuI GTATCC 1 cut(s) 641
BsuRI GGCC 3 cut(s) 5, 498, 779
BtgI CCRYGG 1 cut(s) 364
BtsCI GGATG 2 cut(s) 162, 262
BtsIMutI CAGTG 1 cut(s) 503
Cac8I GCNNGC 4 cut(s) 336, 357, 361, 832
CaiI CAGNNNCTG 1 cut(s) 223
CciI TCATGA 1 cut(s) 931
Csp6I GTAC 3 cut(s) 384, 485, 820
CviAII CATG 6 cut(s) 242, 267, 414, 787, 826, 932
CviQI GTAC 3 cut(s) 384, 485, 820
DdeI CTNAG 7 cut(s) 216, 307, 380, 548, 560, 578, 923
EaeI YGGCCR 3 cut(s) 3, 496, 777
Eco88I CYCGRG 1 cut(s) 345
EcoNI CCTNNNNNAGG 1 cut(s) 648
FaeI CATG 6 cut(s) 245, 270, 417, 790, 829, 935
FatI CATG 6 cut(s) 241, 266, 413, 786, 825, 931
FauNDI CATATG 1 cut(s) 978
FbaI TGATCA 3 cut(s) 79, 735, 928
FblI GTMKAC 1 cut(s) 1017
Fnu4HI GCNGC 9 cut(s) 57, 60, 224, 261, 264, 429, 528, 570, 723
FokI GGATG 2 cut(s) 149, 269
Fsp4HI GCNGC 9 cut(s) 57, 60, 224, 261, 264, 429, 528, 570, 723
FspBI CTAG 1 cut(s) 360
GluI GCNGC 9 cut(s) 57, 60, 224, 261, 264, 429, 528, 570, 723
GsuI CTGGAG 1 cut(s) 267
HaeIII GGCC 3 cut(s) 5, 498, 779
HapII CCGG 4 cut(s) 584, 695, 776, 815
Hin1I GRCGYC 1 cut(s) 891
Hin1II CATG 6 cut(s) 245, 270, 417, 790, 829, 935
HindIII AAGCTT 2 cut(s) 291, 944
HinfI GANTC 3 cut(s) 66, 181, 615
HpaII CCGG 4 cut(s) 584, 695, 776, 815
HphI GGTGA 2 cut(s) 598, 685
Hpy166II GTNNAC 6 cut(s) 368, 463, 487, 703, 820, 1018
Hpy188I TCNGA 5 cut(s) 170, 219, 396, 603, 889
Hpy188III TCNNGA 5 cut(s) 77, 189, 284, 739, 932
Hpy8I GTNNAC 6 cut(s) 368, 463, 487, 703, 820, 1018
HpyAV CCTTC 2 cut(s) 24, 898
HpyCH4III ACNGT 2 cut(s) 74, 733
HpyCH4IV ACGT 4 cut(s) 193, 846, 891, 960
HpyCH4V TGCA 6 cut(s) 56, 62, 96, 175, 790, 881
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 126
HpyF3I CTNAG 7 cut(s) 216, 307, 380, 548, 560, 578, 923
HpySE526I ACGT 4 cut(s) 193, 846, 891, 960
Hsp92I GRCGYC 1 cut(s) 891
Hsp92II CATG 6 cut(s) 245, 270, 417, 790, 829, 935
Ksp22I TGATCA 3 cut(s) 79, 735, 928
LmnI GCTCC 1 cut(s) 713
Lsp1109I GCAGC 7 cut(s) 46, 68, 210, 247, 415, 514, 556
LweI GCATC 2 cut(s) 247, 868
MaeI CTAG 1 cut(s) 360
MaeII ACGT 4 cut(s) 193, 846, 891, 960
MaeIII GTNAC 7 cut(s) 142, 158, 200, 534, 551, 673, 727
MbiI CCGCTC 1 cut(s) 215
MboII GAAGA 3 cut(s) 164, 431, 1030
MfeI CAATTG 1 cut(s) 422
MhlI GDGCHC 1 cut(s) 14
MlsI TGGCCA 2 cut(s) 5, 498
MluCI AATT 5 cut(s) 205, 422, 454, 712, 769
MluNI TGGCCA 2 cut(s) 5, 498
MlyI GAGTC 1 cut(s) 609
MmeI TCCRAC 1 cut(s) 419
Mox20I TGGCCA 2 cut(s) 5, 498
MscI TGGCCA 2 cut(s) 5, 498
MseI TTAA 3 cut(s) 453, 783, 915
MslI CAYNNNNRTG 1 cut(s) 785
Msp20I TGGCCA 2 cut(s) 5, 498
MspA1I CMGCKG 2 cut(s) 59, 569
MspI CCGG 4 cut(s) 584, 695, 776, 815
MspR9I CCNGG 2 cut(s) 584, 696
MunI CAATTG 1 cut(s) 422
Mva1269I GAATGC 1 cut(s) 1006
MvnI CGCG 1 cut(s) 636
MwoI GCNNNNNNNGC 2 cut(s) 56, 126
NciI CCSGG 2 cut(s) 584, 696
NdeI CATATG 1 cut(s) 978
NheI GCTAGC 1 cut(s) 359
NlaIII CATG 6 cut(s) 245, 270, 417, 790, 829, 935
NmuCI GTSAC 2 cut(s) 534, 673
NspI RCATGY 1 cut(s) 790
NspV TTCGAA 1 cut(s) 839
PaeR7I CTCGAG 1 cut(s) 345
PagI TCATGA 1 cut(s) 931
PctI GAATGC 1 cut(s) 1006
PfeI GAWTC 2 cut(s) 66, 181
PflMI CCANNNNNTGG 1 cut(s) 505
PkrI GCNGC 9 cut(s) 58, 61, 225, 262, 265, 430, 529, 571, 724
PleI GAGTC 1 cut(s) 609
PpsI GAGTC 1 cut(s) 609
Ppu21I YACGTR 1 cut(s) 961
PspXI VCTCGAGB 1 cut(s) 345
PstI CTGCAG 1 cut(s) 64
PstNI CAGNNNCTG 1 cut(s) 223
PvuII CAGCTG 2 cut(s) 59, 569
RsaI GTAC 3 cut(s) 385, 486, 821
RsaNI GTAC 3 cut(s) 384, 485, 820
RseI CAYNNNNRTG 1 cut(s) 785
SaqAI TTAA 3 cut(s) 453, 783, 915
SatI GCNGC 9 cut(s) 57, 60, 224, 261, 264, 429, 528, 570, 723
ScaI AGTACT 1 cut(s) 385
SchI GAGTC 1 cut(s) 609
ScrFI CCNGG 2 cut(s) 584, 696
SduI GDGCHC 1 cut(s) 14
SfaNI GCATC 2 cut(s) 247, 868
SfcI CTRYAG 1 cut(s) 60
Sfr274I CTCGAG 1 cut(s) 345
SfuI TTCGAA 1 cut(s) 839
SlaI CTCGAG 1 cut(s) 345
SmiMI CAYNNNNRTG 1 cut(s) 785
SmlI CTYRAG 2 cut(s) 345, 648
SmoI CTYRAG 2 cut(s) 345, 648
Sse9I AATT 5 cut(s) 205, 422, 454, 712, 769
SsiI CCGC 4 cut(s) 213, 264, 634, 722
SspMI CTAG 1 cut(s) 360
StyD4I CCNGG 2 cut(s) 582, 694
TaaI ACNGT 2 cut(s) 74, 733
TaiI ACGT 4 cut(s) 196, 849, 894, 963
TaqI TCGA 3 cut(s) 209, 346, 839
TasI AATT 5 cut(s) 205, 422, 454, 712, 769
TatI WGTACW 3 cut(s) 383, 484, 819
TauI GCSGC 2 cut(s) 266, 725
TfiI GAWTC 2 cut(s) 66, 181
Tru1I TTAA 3 cut(s) 453, 783, 915
Tru9I TTAA 3 cut(s) 453, 783, 915
TscAI CASTG 1 cut(s) 510
TseFI GTSAC 2 cut(s) 534, 673
TseI GCWGC 7 cut(s) 56, 59, 223, 260, 428, 527, 569
Tsp45I GTSAC 2 cut(s) 534, 673
TspDTI ATGAA 1 cut(s) 976
TspRI CASTG 1 cut(s) 510
Van91I CCANNNNNTGG 1 cut(s) 505
XagI CCTNNNNNAGG 1 cut(s) 648
XceI RCATGY 1 cut(s) 790
XhoI CTCGAG 1 cut(s) 345
XmiI GTMKAC 1 cut(s) 1017
XspI CTAG 1 cut(s) 360
ZraI GACGTC 1 cut(s) 892
ZrmI AGTACT 1 cut(s) 385
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.