Rorug02G0464100
ERF Family

Belongs to the AB hydrolase superfamily. Lipase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
59504812 .. 59505399
588 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0464100.1

Sequence Viewer

Length: 189 bp
ATGGGTTTCAATCTAGACATCGAAATACCAGAGTTGAAACTAGGGTTCCATTTGTGGGTTCTTCGATTTGGGGATTTAGGGGTTTCTCGGCGATTCTTGCTGGTTTGCCTTATTTGCAGAGAATCTGCAGCAGACCATCTTCTCCAACCATTCCAAGGCCTCTGCATCACTACTTTCAACAATTGGTAA

Protein Analysis

62

Amino Acids

7.18

Weight (kDa)

6.0

Isoelectric Point (pI)

54.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000706)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 55, 155
AgsI TTSAA 3 cut(s) 10, 37, 178
AoxI GGCC 1 cut(s) 157
ApeKI GCWGC 1 cut(s) 128
BbvI GCAGC 1 cut(s) 140
BccI CCATC 1 cut(s) 144
BfaI CTAG 2 cut(s) 14, 41
BfmI CTRYAG 1 cut(s) 126
BisI GCNGC 1 cut(s) 129
BlsI GCNGC 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 47
BmsI GCATC 1 cut(s) 174
BsaJI CCNNGG 1 cut(s) 154
Bsc4I CCNNNNNNNGG 2 cut(s) 55, 155
BseDI CCNNGG 1 cut(s) 154
BseLI CCNNNNNNNGG 2 cut(s) 55, 155
BseXI GCAGC 1 cut(s) 140
BshFI GGCC 1 cut(s) 159
BslI CCNNNNNNNGG 2 cut(s) 55, 155
BsnI GGCC 1 cut(s) 159
BspANI GGCC 1 cut(s) 159
BspLI GGNNCC 1 cut(s) 47
BspMAI CTGCAG 1 cut(s) 130
BssECI CCNNGG 1 cut(s) 154
BssT1I CCWWGG 1 cut(s) 154
BstMWI GCNNNNNNNGC 2 cut(s) 97, 114
BstSFI CTRYAG 1 cut(s) 126
BstV1I GCAGC 1 cut(s) 140
BsuRI GGCC 1 cut(s) 159
CviJI RGCY 1 cut(s) 159
CviKI_1 RGCY 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 154
Eco147I AGGCCT 1 cut(s) 159
EcoT14I CCWWGG 1 cut(s) 154
ErhI CCWWGG 1 cut(s) 154
Fnu4HI GCNGC 1 cut(s) 129
Fsp4HI GCNGC 1 cut(s) 129
FspBI CTAG 2 cut(s) 14, 41
GluI GCNGC 1 cut(s) 129
HaeIII GGCC 1 cut(s) 159
HinfI GANTC 2 cut(s) 93, 122
Hpy188III TCNNGA 1 cut(s) 14
HpyCH4V TGCA 3 cut(s) 117, 128, 165
HpyF10VI GCNNNNNNNGC 2 cut(s) 97, 114
LpnPI CCDG 2 cut(s) 42, 86
Lsp1109I GCAGC 1 cut(s) 140
LweI GCATC 1 cut(s) 174
MaeI CTAG 2 cut(s) 14, 41
MboII GAAGA 2 cut(s) 53, 131
MfeI CAATTG 1 cut(s) 181
MluCI AATT 1 cut(s) 181
MmeI TCCRAC 1 cut(s) 169
MnlI CCTC 1 cut(s) 170
MunI CAATTG 1 cut(s) 181
MwoI GCNNNNNNNGC 2 cut(s) 97, 114
NlaIV GGNNCC 1 cut(s) 47
NmeAIII GCCGAG 1 cut(s) 67
PceI AGGCCT 1 cut(s) 159
PfeI GAWTC 2 cut(s) 93, 122
PkrI GCNGC 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 47
PstI CTGCAG 1 cut(s) 130
SatI GCNGC 1 cut(s) 129
SfaNI GCATC 1 cut(s) 174
SfcI CTRYAG 1 cut(s) 126
SgeI CNNG 7 cut(s) 26, 41, 53, 99, 109, 113, 167
Sse9I AATT 1 cut(s) 181
SseBI AGGCCT 1 cut(s) 159
SspMI CTAG 2 cut(s) 14, 41
StuI AGGCCT 1 cut(s) 159
StyI CCWWGG 1 cut(s) 154
TaqI TCGA 2 cut(s) 21, 64
TasI AATT 1 cut(s) 181
TfiI GAWTC 2 cut(s) 93, 122
TseI GCWGC 1 cut(s) 128
XbaI TCTAGA 1 cut(s) 13
XspI CTAG 2 cut(s) 14, 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.