Rmu_sc0002680.1_g000019

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002680.1
Physical Location & Seq
Reverse (-)
80394 .. 80705
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002680.1_g000019.1.cds

Sequence Viewer

Length: 312 bp
atgctaccagacaagtataggctggagtatgacaacaaaagaatcacaaccttcaataagttgatcagcctactgcaagtggctaagaggcaaaatgaggatctcttgaacaacaatgctaggcccactaggacaaagaaaattctcgaggctaattatggaaaaataaaaggtggaaagaactccaatgcaaaggggtttggacgtgctgatccctacccacgtggcaacaatgcaccacatggaaagggacgtggaggtgatggaaacaaggtgcaaaaggcacctaagaaactcagtcaaacaggatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.45

Weight (kDa)

10.42

Isoelectric Point (pI)

27.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 283
AclWI GGATC 2 cut(s) 108, 206
AcsI RAATTY 1 cut(s) 141
AcvI CACGTG 1 cut(s) 224
AgsI TTSAA 2 cut(s) 55, 109
AjiI CACGTC 2 cut(s) 206, 254
AlwI GGATC 2 cut(s) 108, 206
Ama87I CYCGRG 1 cut(s) 146
AoxI GGCC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 141
AspS9I GGNCC 1 cut(s) 123
AsuHPI GGTGA 1 cut(s) 272
AvaI CYCGRG 1 cut(s) 146
BanI GGYRCC 1 cut(s) 283
BbrPI CACGTG 1 cut(s) 224
BccI CCATC 1 cut(s) 257
BclI TGATCA 1 cut(s) 63
BfaI CTAG 2 cut(s) 120, 129
BmeT110I CYCGRG 1 cut(s) 146
BmgBI CACGTC 2 cut(s) 206, 254
BmgT120I GGNCC 1 cut(s) 123
BmiI GGNNCC 1 cut(s) 285
BpmI CTGGAG 1 cut(s) 44
BsaAI YACGTR 1 cut(s) 224
BseMII CTCAG 1 cut(s) 310
BshFI GGCC 1 cut(s) 124
BshNI GGYRCC 1 cut(s) 283
BsiHKCI CYCGRG 1 cut(s) 146
BslFI GGGAC 1 cut(s) 264
BsmFI GGGAC 1 cut(s) 264
BsnI GGCC 1 cut(s) 124
BsoBI CYCGRG 1 cut(s) 146
Bsp143I GATC 3 cut(s) 63, 100, 211
BspANI GGCC 1 cut(s) 124
BspCNI CTCAG 1 cut(s) 309
BspLI GGNNCC 1 cut(s) 285
BspPI GGATC 2 cut(s) 108, 206
BspT107I GGYRCC 1 cut(s) 283
BssMI GATC 3 cut(s) 63, 100, 211
BstBAI YACGTR 1 cut(s) 224
BstDEI CTNAG 3 cut(s) 84, 288, 296
BstKTI GATC 3 cut(s) 66, 103, 214
BstMBI GATC 3 cut(s) 63, 100, 211
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BsuRI GGCC 1 cut(s) 124
BtrI CACGTC 2 cut(s) 206, 254
Cfr13I GGNCC 1 cut(s) 123
CviAII CATG 1 cut(s) 242
CviJI RGCY 5 cut(s) 22, 69, 83, 124, 152
CviKI_1 RGCY 5 cut(s) 22, 69, 83, 124, 152
DdeI CTNAG 3 cut(s) 84, 288, 296
DpnI GATC 3 cut(s) 65, 102, 213
DpnII GATC 3 cut(s) 63, 100, 211
Eco72I CACGTG 1 cut(s) 224
Eco88I CYCGRG 1 cut(s) 146
FaeI CATG 1 cut(s) 245
FaiI YATR 4 cut(s) 18, 30, 159, 243
FaqI GGGAC 1 cut(s) 264
FatI CATG 1 cut(s) 241
FbaI TGATCA 1 cut(s) 63
FspBI CTAG 2 cut(s) 120, 129
GsuI CTGGAG 1 cut(s) 44
HaeIII GGCC 1 cut(s) 124
Hin1II CATG 1 cut(s) 245
HinfI GANTC 1 cut(s) 42
HphI GGTGA 1 cut(s) 272
Hpy188III TCNNGA 2 cut(s) 106, 146
HpyAV CCTTC 1 cut(s) 61
HpyCH4IV ACGT 3 cut(s) 205, 223, 253
HpyCH4V TGCA 4 cut(s) 76, 191, 236, 277
HpyF3I CTNAG 3 cut(s) 84, 288, 296
HpySE526I ACGT 3 cut(s) 205, 223, 253
Hsp92II CATG 1 cut(s) 245
Ksp22I TGATCA 1 cut(s) 63
Kzo9I GATC 3 cut(s) 63, 100, 211
LpnPI CCDG 3 cut(s) 8, 21, 291
MaeI CTAG 2 cut(s) 120, 129
MaeII ACGT 3 cut(s) 205, 223, 253
MalI GATC 3 cut(s) 65, 102, 213
MboI GATC 3 cut(s) 63, 100, 211
MflI RGATCY 1 cut(s) 100
MluCI AATT 2 cut(s) 141, 154
MnlI CCTC 4 cut(s) 81, 91, 142, 251
NdeII GATC 3 cut(s) 63, 100, 211
NlaIII CATG 1 cut(s) 245
NlaIV GGNNCC 1 cut(s) 285
PaeR7I CTCGAG 1 cut(s) 146
PfeI GAWTC 1 cut(s) 42
PmaCI CACGTG 1 cut(s) 224
PmlI CACGTG 1 cut(s) 224
Ppu21I YACGTR 1 cut(s) 224
PspCI CACGTG 1 cut(s) 224
PspN4I GGNNCC 1 cut(s) 285
PspPI GGNCC 1 cut(s) 123
PsuI RGATCY 1 cut(s) 100
Sau3AI GATC 3 cut(s) 63, 100, 211
Sau96I GGNCC 1 cut(s) 123
SetI ASST 8 cut(s) 53, 175, 208, 226, 256, 262, 276, 289
Sfr274I CTCGAG 1 cut(s) 146
SlaI CTCGAG 1 cut(s) 146
SmlI CTYRAG 1 cut(s) 146
SmoI CTYRAG 1 cut(s) 146
Sse9I AATT 2 cut(s) 141, 154
SspMI CTAG 2 cut(s) 120, 129
TaiI ACGT 3 cut(s) 208, 226, 256
TaqI TCGA 1 cut(s) 147
TasI AATT 2 cut(s) 141, 154
TfiI GAWTC 1 cut(s) 42
XapI RAATTY 1 cut(s) 141
XhoI CTCGAG 1 cut(s) 146
XspI CTAG 2 cut(s) 120, 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.