Rmu_sc0003834.1_g000007

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003834.1
OG0000956
Physical Location & Seq
Forward (+)
22872 .. 24089
1218 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003834.1_g000007.1.cds

Sequence Viewer

Length: 1218 bp
atgcttaacatgtctaatcttagatccatcgatattaatgtcacggacgagagtgcttgggtcgaatctggggctactcttggtgaactttatttcaatattggaaacaaaagcaatattcatgggtttcctgctggagtttgccctactgttggtattggtggccatcttagtggtggtggttatggccctttgatgagaaaatatggacttacagtggataacattgtagatgctaagctagtgaatgtgaacggtacaattcttgatagaaaatccatgagagaagaccttttctgggccattagaggaggtggtggtgcaagctttggagtcgttgtttcttggaagatcaaattggttccagttccaaccaaagtgactgtattcaatgttttaaggaccttggaacacggcgctatagatatcgtttatcggtggcaatacgtagcgcctaaactgcctaaagagatcttcattagggcaatgcttcaagtgaagaaaaatagtacttcaggtaagttggctgtggaagtgtcattcatctgtcattatttgggagataatgagaaacttctttcattgatgaatcggaattttcctgaattgggtttgcagcaaaatgattgctttgaaatgagttgggtagaatccactgtgttctggggtaaccacccaattggaactcctttagctgttctgcttgataggccgatggggccaccagatttcttcaagagcaagtcagactatgtgaaagagccgattccgaaacatggaatagaatccatattggacttgatgctaaagacgggtctagataaactgtacatggaatggaacccttacggtggaagaatgagtgagatttcagagtcggaaactccattccctcacagggctggaaacctgtttttgattcagtatttgggatattggaaagaagacaaggctgagacagcccacagctaccttgatttgattagcaaaatgtatcaagaaatgactccatttgtgtccaagaccccaagagaggccttcctaaactatagggatcttgaccttggggccagtaagggtaatcagactaaagttgaaactgcaagagtttatggaagcatgtattttaaagaaaactttgatagactggtacgtgtgaaaactgcggttgatcctcagaattttttcaagaatgaacagagcattccaccactgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BBE FAD_binding_4

Protein Analysis

405

Amino Acids

45.6

Weight (kDa)

7.68

Isoelectric Point (pI)

29.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 1166
AclWI GGATC 3 cut(s) 18, 1062, 1166
AcoI YGGCCR 1 cut(s) 163
AcsI RAATTY 2 cut(s) 595, 1180
AcuI CTGAAG 1 cut(s) 498
AfaI GTAC 4 cut(s) 259, 511, 830, 1152
AfiI CCNNNNNNNGG 7 cut(s) 152, 298, 608, 776, 851, 898, 1033
AflIII ACRYGT 2 cut(s) 9, 1153
AgsI TTSAA 7 cut(s) 97, 391, 494, 635, 736, 1097, 1189
AjuI GAANNNNNNNTTGG 2 cut(s) 341, 373
AluBI AGCT 4 cut(s) 241, 327, 695, 969
AluI AGCT 4 cut(s) 241, 327, 695, 969
Alw26I GTCTC 1 cut(s) 950
AlwI GGATC 3 cut(s) 18, 1062, 1166
AoxI GGCC 7 cut(s) 163, 187, 300, 710, 719, 1035, 1068
ApeKI GCWGC 1 cut(s) 616
ApoI RAATTY 2 cut(s) 595, 1180
AseI ATTAAT 1 cut(s) 36
Asp700I GAANNNNTTC 1 cut(s) 1184
AspLEI GCGC 2 cut(s) 419, 454
AspS9I GGNCC 5 cut(s) 188, 300, 402, 719, 1068
AsuHPI GGTGA 1 cut(s) 95
AvaII GGWCC 1 cut(s) 402
BalI TGGCCA 1 cut(s) 165
BbsI GAAGAC 2 cut(s) 294, 951
BbvI GCAGC 1 cut(s) 628
BccI CCATC 3 cut(s) 35, 174, 709
BceAI ACGGC 1 cut(s) 430
BcoDI GTCTC 1 cut(s) 950
BfaI CTAG 2 cut(s) 242, 818
BfmI CTRYAG 3 cut(s) 420, 1048, 1214
BfoI RGCGCY 2 cut(s) 420, 455
BglI GCCNNNNNGGC 1 cut(s) 718
BglII AGATCT 1 cut(s) 471
BisI GCNGC 1 cut(s) 617
BlpI GCTNAGC 1 cut(s) 237
BlsI GCNGC 1 cut(s) 618
BmcAI AGTACT 1 cut(s) 511
Bme18I GGWCC 1 cut(s) 402
BmgT120I GGNCC 5 cut(s) 188, 300, 402, 719, 1068
BmiI GGNNCC 4 cut(s) 363, 720, 842, 1069
BmsI GCATC 2 cut(s) 223, 792
BpiI GAAGAC 2 cut(s) 294, 951
BpmI CTGGAG 1 cut(s) 156
Bpu1102I GCTNAGC 1 cut(s) 237
Bsa29I ATCGAT 1 cut(s) 30
BsaAI YACGTR 2 cut(s) 448, 1154
BsaJI CCNNGG 2 cut(s) 405, 1063
BsaXI ACNNNNNCTCC 2 cut(s) 324, 354
Bsc4I CCNNNNNNNGG 7 cut(s) 152, 298, 608, 776, 851, 898, 1033
Bse1I ACTGG 3 cut(s) 365, 1071, 1152
Bse3DI GCAATG 1 cut(s) 492
BseCI ATCGAT 1 cut(s) 30
BseDI CCNNGG 2 cut(s) 405, 1063
BseLI CCNNNNNNNGG 7 cut(s) 152, 298, 608, 776, 851, 898, 1033
BseMI GCAATG 1 cut(s) 492
BseMII CTCAG 2 cut(s) 945, 1190
BseNI ACTGG 3 cut(s) 365, 1071, 1152
BseRI GAGGAG 1 cut(s) 324
BseXI GCAGC 1 cut(s) 628
BshFI GGCC 7 cut(s) 165, 189, 302, 712, 721, 1037, 1070
BshVI ATCGAT 1 cut(s) 30
BslI CCNNNNNNNGG 7 cut(s) 152, 298, 608, 776, 851, 898, 1033
BsmAI GTCTC 1 cut(s) 950
BsmI GAATGC 1 cut(s) 1203
BsnI GGCC 7 cut(s) 165, 189, 302, 712, 721, 1037, 1070
Bsp1407I TGTACA 1 cut(s) 828
Bsp143I GATC 5 cut(s) 23, 351, 471, 1054, 1171
Bsp1720I GCTNAGC 1 cut(s) 237
BspACI CCGC 1 cut(s) 1166
BspANI GGCC 7 cut(s) 165, 189, 302, 712, 721, 1037, 1070
BspCNI CTCAG 2 cut(s) 946, 1189
BspDI ATCGAT 1 cut(s) 30
BspLI GGNNCC 4 cut(s) 363, 720, 842, 1069
BspPI GGATC 3 cut(s) 18, 1062, 1166
BsrDI GCAATG 1 cut(s) 492
BsrGI TGTACA 1 cut(s) 828
BsrI ACTGG 3 cut(s) 365, 1071, 1152
BssECI CCNNGG 2 cut(s) 405, 1063
BssMI GATC 5 cut(s) 23, 351, 471, 1054, 1171
BssT1I CCWWGG 2 cut(s) 405, 1063
Bst4CI ACNGT 8 cut(s) 151, 217, 257, 385, 658, 828, 851, 1215
BstAUI TGTACA 1 cut(s) 828
BstBAI YACGTR 2 cut(s) 448, 1154
BstC8I GCNNGC 1 cut(s) 325
BstDEI CTNAG 5 cut(s) 20, 170, 237, 954, 1176
BstEII GGTNACC 1 cut(s) 668
BstH2I RGCGCY 2 cut(s) 420, 455
BstHHI GCGC 2 cut(s) 419, 454
BstKTI GATC 5 cut(s) 26, 354, 474, 1057, 1174
BstMAI GTCTC 1 cut(s) 950
BstMBI GATC 5 cut(s) 23, 351, 471, 1054, 1171
BstMWI GCNNNNNNNGC 4 cut(s) 460, 709, 718, 959
BstNSI RCATGY 2 cut(s) 13, 1123
BstPI GGTNACC 1 cut(s) 668
BstSFI CTRYAG 3 cut(s) 420, 1048, 1214
BstSNI TACGTA 1 cut(s) 448
BstV1I GCAGC 1 cut(s) 628
BstV2I GAAGAC 2 cut(s) 294, 951
BstX2I RGATCY 3 cut(s) 23, 471, 1054
BstXI CCANNNNNNTGG 2 cut(s) 173, 680
BstYI RGATCY 3 cut(s) 23, 471, 1054
Bsu15I ATCGAT 1 cut(s) 30
BsuRI GGCC 7 cut(s) 165, 189, 302, 712, 721, 1037, 1070
BsuTUI ATCGAT 1 cut(s) 30
BtsIMutI CAGTG 3 cut(s) 222, 654, 1211
Cac8I GCNNGC 1 cut(s) 325
CfoI GCGC 2 cut(s) 419, 454
Cfr13I GGNCC 5 cut(s) 188, 300, 402, 719, 1068
ClaI ATCGAT 1 cut(s) 30
Csp6I GTAC 4 cut(s) 258, 510, 829, 1151
CviAII CATG 6 cut(s) 10, 122, 280, 776, 832, 1120
CviQI GTAC 4 cut(s) 258, 510, 829, 1151
DdeI CTNAG 5 cut(s) 20, 170, 237, 954, 1176
DpnI GATC 5 cut(s) 25, 353, 473, 1056, 1173
DpnII GATC 5 cut(s) 23, 351, 471, 1054, 1171
DraI TTTAAA 1 cut(s) 1129
EaeI YGGCCR 1 cut(s) 163
Eco105I TACGTA 1 cut(s) 448
Eco130I CCWWGG 2 cut(s) 405, 1063
Eco147I AGGCCT 1 cut(s) 1037
Eco32I GATATC 1 cut(s) 427
Eco47I GGWCC 1 cut(s) 402
Eco57I CTGAAG 1 cut(s) 498
Eco91I GGTNACC 1 cut(s) 668
EcoO109I RGGNCCY 1 cut(s) 402
EcoO65I GGTNACC 1 cut(s) 668
EcoRV GATATC 1 cut(s) 427
EcoT14I CCWWGG 2 cut(s) 405, 1063
ErhI CCWWGG 2 cut(s) 405, 1063
FaeI CATG 6 cut(s) 13, 125, 283, 779, 835, 1123
FatI CATG 6 cut(s) 9, 121, 279, 775, 831, 1119
Fnu4HI GCNGC 1 cut(s) 617
Fsp4HI GCNGC 1 cut(s) 617
FspBI CTAG 2 cut(s) 242, 818
GlaI GCGC 2 cut(s) 418, 453
GluI GCNGC 1 cut(s) 617
GsuI CTGGAG 1 cut(s) 156
HaeII RGCGCY 2 cut(s) 420, 455
HaeIII GGCC 7 cut(s) 165, 189, 302, 712, 721, 1037, 1070
HhaI GCGC 2 cut(s) 419, 454
Hin1II CATG 6 cut(s) 13, 125, 283, 779, 835, 1123
Hin6I GCGC 2 cut(s) 417, 452
HinP1I GCGC 2 cut(s) 417, 452
HindIII AAGCTT 1 cut(s) 325
HinfI GANTC 9 cut(s) 65, 333, 589, 650, 766, 785, 875, 919, 1006
HphI GGTGA 1 cut(s) 95
Hpy166II GTNNAC 2 cut(s) 86, 253
Hpy188I TCNGA 7 cut(s) 594, 748, 771, 874, 880, 1086, 1179
Hpy188III TCNNGA 7 cut(s) 266, 602, 736, 818, 998, 1058, 1189
Hpy8I GTNNAC 2 cut(s) 86, 253
HpyAV CCTTC 1 cut(s) 1048
HpyCH4III ACNGT 8 cut(s) 151, 217, 257, 385, 658, 828, 851, 1215
HpyCH4IV ACGT 2 cut(s) 447, 1153
HpyCH4V TGCA 3 cut(s) 323, 616, 1103
HpyF10VI GCNNNNNNNGC 4 cut(s) 460, 709, 718, 959
HpyF3I CTNAG 5 cut(s) 20, 170, 237, 954, 1176
HpySE526I ACGT 2 cut(s) 447, 1153
Hsp92II CATG 6 cut(s) 13, 125, 283, 779, 835, 1123
HspAI GCGC 2 cut(s) 417, 452
Kzo9I GATC 5 cut(s) 23, 351, 471, 1054, 1171
Lsp1109I GCAGC 1 cut(s) 628
LweI GCATC 2 cut(s) 223, 792
MaeI CTAG 2 cut(s) 242, 818
MaeII ACGT 2 cut(s) 447, 1153
MaeIII GTNAC 3 cut(s) 40, 379, 668
MalI GATC 5 cut(s) 25, 353, 473, 1056, 1173
MboI GATC 5 cut(s) 23, 351, 471, 1054, 1171
MboII GAAGA 7 cut(s) 299, 361, 466, 511, 724, 867, 956
MfeI CAATTG 1 cut(s) 678
MflI RGATCY 3 cut(s) 23, 471, 1054
MlsI TGGCCA 1 cut(s) 165
MluCI AATT 6 cut(s) 261, 356, 595, 605, 678, 1180
MluNI TGGCCA 1 cut(s) 165
MlyI GAGTC 3 cut(s) 342, 884, 1000
MmeI TCCRAC 2 cut(s) 395, 858
MnlI CCTC 5 cut(s) 302, 305, 903, 1027, 1185
Mox20I TGGCCA 1 cut(s) 165
MroXI GAANNNNTTC 1 cut(s) 1184
MscI TGGCCA 1 cut(s) 165
MseI TTAA 4 cut(s) 6, 36, 398, 1128
MslI CAYNNNNRTG 1 cut(s) 171
Msp20I TGGCCA 1 cut(s) 165
MunI CAATTG 1 cut(s) 678
Mva1269I GAATGC 1 cut(s) 1203
MwoI GCNNNNNNNGC 4 cut(s) 460, 709, 718, 959
NdeII GATC 5 cut(s) 23, 351, 471, 1054, 1171
NlaIII CATG 6 cut(s) 13, 125, 283, 779, 835, 1123
NlaIV GGNNCC 4 cut(s) 363, 720, 842, 1069
NmuCI GTSAC 2 cut(s) 40, 379
NspI RCATGY 2 cut(s) 13, 1123
PceI AGGCCT 1 cut(s) 1037
PciI ACATGT 1 cut(s) 9
PctI GAATGC 1 cut(s) 1203
PdmI GAANNNNTTC 1 cut(s) 1184
PfeI GAWTC 6 cut(s) 65, 589, 650, 766, 785, 919
PkrI GCNGC 1 cut(s) 618
PleI GAGTC 3 cut(s) 341, 883, 1000
PpsI GAGTC 3 cut(s) 341, 883, 1000
Ppu21I YACGTR 2 cut(s) 448, 1154
PpuMI RGGWCCY 1 cut(s) 402
PscI ACATGT 1 cut(s) 9
PshBI ATTAAT 1 cut(s) 36
Psp5II RGGWCCY 1 cut(s) 402
PspEI GGTNACC 1 cut(s) 668
PspN4I GGNNCC 4 cut(s) 363, 720, 842, 1069
PspPI GGNCC 5 cut(s) 188, 300, 402, 719, 1068
PspPPI RGGWCCY 1 cut(s) 402
PsuI RGATCY 3 cut(s) 23, 471, 1054
RsaI GTAC 4 cut(s) 259, 511, 830, 1152
RsaNI GTAC 4 cut(s) 258, 510, 829, 1151
RseI CAYNNNNRTG 1 cut(s) 171
SaqAI TTAA 4 cut(s) 6, 36, 398, 1128
SatI GCNGC 1 cut(s) 617
Sau3AI GATC 5 cut(s) 23, 351, 471, 1054, 1171
Sau96I GGNCC 5 cut(s) 188, 300, 402, 719, 1068
ScaI AGTACT 1 cut(s) 511
SchI GAGTC 3 cut(s) 342, 884, 1000
SfaNI GCATC 2 cut(s) 223, 792
SfcI CTRYAG 3 cut(s) 420, 1048, 1214
SfiI GGCCNNNNNGGCC 1 cut(s) 718
SinI GGWCC 1 cut(s) 402
SmiMI CAYNNNNRTG 1 cut(s) 171
SnaBI TACGTA 1 cut(s) 448
Sse9I AATT 6 cut(s) 261, 356, 595, 605, 678, 1180
SseBI AGGCCT 1 cut(s) 1037
SsiI CCGC 1 cut(s) 1166
SspI AATATT 2 cut(s) 100, 118
SspMI CTAG 2 cut(s) 242, 818
StuI AGGCCT 1 cut(s) 1037
StyI CCWWGG 2 cut(s) 405, 1063
TaaI ACNGT 8 cut(s) 151, 217, 257, 385, 658, 828, 851, 1215
TaiI ACGT 2 cut(s) 450, 1156
TaqI TCGA 2 cut(s) 30, 63
TasI AATT 6 cut(s) 261, 356, 595, 605, 678, 1180
TatI WGTACW 2 cut(s) 509, 828
TfiI GAWTC 6 cut(s) 65, 589, 650, 766, 785, 919
Tru1I TTAA 4 cut(s) 6, 36, 398, 1128
Tru9I TTAA 4 cut(s) 6, 36, 398, 1128
TscAI CASTG 3 cut(s) 222, 661, 1218
TseFI GTSAC 2 cut(s) 40, 379
TseI GCWGC 1 cut(s) 616
Tsp45I GTSAC 2 cut(s) 40, 379
TspDTI ATGAA 6 cut(s) 110, 466, 532, 570, 602, 1209
TspGWI ACGGA 1 cut(s) 59
TspRI CASTG 3 cut(s) 222, 661, 1218
VpaK11BI GGWCC 1 cut(s) 402
VspI ATTAAT 1 cut(s) 36
XapI RAATTY 2 cut(s) 595, 1180
XbaI TCTAGA 1 cut(s) 817
XceI RCATGY 2 cut(s) 13, 1123
XcmI CCANNNNNNNNNTGG 1 cut(s) 173
XmnI GAANNNNTTC 1 cut(s) 1184
XspI CTAG 2 cut(s) 242, 818
ZrmI AGTACT 1 cut(s) 511
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.