Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003834.1

Orthogroup ID

OG0000956

Physical Location & Seq

Genomic Coordinates Forward (+)

44369 .. 45437

Gene Structure 1069 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003834.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 849 bp

atgggagaagacctattttgggccattagaggaggtggtggagcaagctttggagtcattctttcatggaagatcaaattgcttcaagttccacccgttgtcactgttttcagaattacaaagacactggagcaaggcgctacggatgttcttcacaggtggcaatacgttgcgcctaacctacctaaagaactcttcattagagcaacttcaaaagtccagaatagtactaccgaagcaggaaagaagactgtggaaatggtattcaatggtctctatctaggacaacgggaaaaccttcttcctttggctataataaaaagaccaacggaaccacctccattcttcttcaaaggcaagtcggattatgtaaaacaaccaattctgaaagaggtcttgaagtcgatattcgagaagatgatcaatcgatacgagtcgacgcacatgcaatggaacccatatggtggaagaatgaatgagatttccgagtcggaaactccattccctcacagagcaggaaacctatttatgattcagtactggacgtattggatggaaaaagggattgagagcaccaacaagtaccttaacttgtcgagaaatttgtacggaagtatgactccgtacgtgtccaagagcccaagagaggtcttgcataactatagggatcttgacataggctccaatatgcttaaccagaccagcattgagcatgctagagtttatggaagaacgtattttaaaggcaattttgaaagattggtacgtgtgaaaagtgctgttgatcctcagaattttttcaagcatgaacaaagtatcccaccgctgtcgagaatgggagaggaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BBE FAD_binding_4

Protein Analysis

282

Amino Acids

32.64

Weight (kDa)

9.57

Isoelectric Point (pI)

33.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000956)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G26380 AT1G26390 AT1G26400 AT1G26410 AT1G26420 AT4G20800
fragaria_vesca	FvH4_3g11042 FvH4_3g11043 FvH4_3g11044 FvH4_3g11090
malus_domestica	MD05G1266700.v1.1 MD05G1266800.v1.1 MD05G1267200.v1.1 MD05G1267300.v1.1 MD10G1243900.v1.1 MD10G1244000.v1.1
prunus_persica	Prupe.1G032800_v2.0.a1 Prupe.4G092300_v2.0.a1 Prupe.4G098500_v2.0.a1 Prupe.4G098600_v2.0.a1 Prupe.4G098700_v2.0.a1 Prupe.4G098900_v2.0.a1 Prupe.4G099000_v2.0.a1 Prupe.4G099100_v2.0.a1 Prupe.4G099200_v2.0.a1 Prupe.4G099400_v2.0.a1 Prupe.4G230400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0017771 RchiOBHm_Chr5g0017801 RchiOBHm_Chr5g0017831 RchiOBHm_Chr5g0017861 RchiOBHm_Chr5g0017931 RchiOBHm_Chr5g0017951 RchiOBHm_Chr5g0017981
rosa_laevigata	RLG00000032314 RLG00000032315 RLG00000032316 RLG00000032324 RLG00000032325 RLG00000032328 RLG00000032349
rosa_multiflora	Rmu_sc0003375.1_g000007 Rmu_sc0003834.1_g000007 Rmu_sc0003834.1_g000013 Rmu_sc0003834.1_g000014 Rmu_sc0005929.1_g000010 Rmu_sc0005929.1_g000016 Rmu_sc0011118.1_g000003 Rmu_sc0011171.1_g000007 Rmu_sc0013814.1_g000002 Rmu_sc0014753.1_g000007
rosa_roxburghii	Rroxscaffold_1G00059450 Rroxscaffold_1G00059620 Rroxscaffold_1G00059700 Rroxscaffold_1G00059710
rosa_rugosa	Rorug05G0038600 Rorug05G0038700 Rorug05G0038900 Rorug05G0039200 Rorug05G0039300
rosa_wichuraiana	Rw5G011460 Rw5G011500 Rw5G011520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	464
AccI	GTMKAC	1 cut(s)	437
AciI	CCGC	1 cut(s)	824
AclWI	GGATC	2 cut(s)	675, 779
AcsI	RAATTY	2 cut(s)	601, 793
AfaI	GTAC	6 cut(s)	229, 539, 584, 608, 626, 765
AfiI	CCNNNNNNNGG	3 cut(s)	19, 464, 646
AflIII	ACRYGT	2 cut(s)	627, 766
AgsI	TTSAA	7 cut(s)	86, 213, 268, 352, 400, 755, 802
AloI	GAACNNNNNNTCC	2 cut(s)	801, 833
AluBI	AGCT	1 cut(s)	48
AluI	AGCT	1 cut(s)	48
Alw21I	GWGCWC	1 cut(s)	575
Alw26I	GTCTC	1 cut(s)	278
AlwI	GGATC	2 cut(s)	675, 779
AoxI	GGCC	1 cut(s)	21
ApoI	RAATTY	2 cut(s)	601, 793
Asp700I	GAANNNNTTC	2 cut(s)	297, 797
AspLEI	GCGC	2 cut(s)	140, 175
AspS9I	GGNCC	1 cut(s)	21
BanII	GRGCYC	1 cut(s)	641
BbsI	GAAGAC	2 cut(s)	15, 254
Bbv12I	GWGCWC	1 cut(s)	575
BccI	CCATC	1 cut(s)	547
BcgI	CGANNNNNNTGC	2 cut(s)	427, 461
BciVI	GTATCC	1 cut(s)	827
BclI	TGATCA	1 cut(s)	420
BcoDI	GTCTC	1 cut(s)	278
BfaI	CTAG	2 cut(s)	281, 717
BfmI	CTRYAG	1 cut(s)	661
BfoI	RGCGCY	1 cut(s)	141
BfuI	GTATCC	1 cut(s)	827
BmcAI	AGTACT	2 cut(s)	229, 539
BmgT120I	GGNCC	1 cut(s)	21
BmiI	GGNNCC	3 cut(s)	333, 455, 682
BpiI	GAAGAC	2 cut(s)	15, 254
BpmI	CTGGAG	1 cut(s)	149
Bsa29I	ATCGAT	1 cut(s)	427
BsaAI	YACGTR	2 cut(s)	628, 767
BsaI	GGTCTC	1 cut(s)	278
BsaXI	ACNNNNNCTCC	2 cut(s)	665, 695
Bsc4I	CCNNNNNNNGG	3 cut(s)	19, 464, 646
Bse1I	ACTGG	2 cut(s)	132, 545
Bse3DI	GCAATG	1 cut(s)	455
BseCI	ATCGAT	1 cut(s)	427
BseGI	GGATG	2 cut(s)	151, 558
BseLI	CCNNNNNNNGG	3 cut(s)	19, 464, 646
BseMI	GCAATG	1 cut(s)	455
BseMII	CTCAG	1 cut(s)	803
BseNI	ACTGG	2 cut(s)	132, 545
BseRI	GAGGAG	1 cut(s)	45
BshFI	GGCC	1 cut(s)	23
BshVI	ATCGAT	1 cut(s)	427
BsiHKAI	GWGCWC	1 cut(s)	575
BsiWI	CGTACG	1 cut(s)	624
BslI	CCNNNNNNNGG	3 cut(s)	19, 464, 646
BsmAI	GTCTC	1 cut(s)	278
BsnI	GGCC	1 cut(s)	23
Bso31I	GGTCTC	1 cut(s)	278
Bsp1286I	GDGCHC	2 cut(s)	575, 641
Bsp143I	GATC	4 cut(s)	72, 420, 667, 784
BspACI	CCGC	1 cut(s)	824
BspANI	GGCC	1 cut(s)	23
BspCNI	CTCAG	1 cut(s)	802
BspDI	ATCGAT	1 cut(s)	427
BspLI	GGNNCC	3 cut(s)	333, 455, 682
BspPI	GGATC	2 cut(s)	675, 779
BspTNI	GGTCTC	1 cut(s)	278
BsrDI	GCAATG	1 cut(s)	455
BsrI	ACTGG	2 cut(s)	132, 545
BssMI	GATC	4 cut(s)	72, 420, 667, 784
Bst4CI	ACNGT	2 cut(s)	106, 253
Bst6I	CTCTTC	1 cut(s)	200
BstBAI	YACGTR	2 cut(s)	628, 767
BstC8I	GCNNGC	2 cut(s)	46, 714
BstDEI	CTNAG	1 cut(s)	789
BstF5I	GGATG	2 cut(s)	151, 558
BstH2I	RGCGCY	1 cut(s)	141
BstHHI	GCGC	2 cut(s)	140, 175
BstKTI	GATC	4 cut(s)	75, 423, 670, 787
BstMAI	GTCTC	1 cut(s)	278
BstMBI	GATC	4 cut(s)	72, 420, 667, 784
BstNSI	RCATGY	2 cut(s)	448, 716
BstSFI	CTRYAG	1 cut(s)	661
BstV2I	GAAGAC	2 cut(s)	15, 254
BstX2I	RGATCY	1 cut(s)	667
BstYI	RGATCY	1 cut(s)	667
Bsu15I	ATCGAT	1 cut(s)	427
BsuI	GTATCC	1 cut(s)	827
BsuRI	GGCC	1 cut(s)	23
BsuTUI	ATCGAT	1 cut(s)	427
BtsCI	GGATG	2 cut(s)	151, 558
BtsIMutI	CAGTG	2 cut(s)	102, 125
Cac8I	GCNNGC	2 cut(s)	46, 714
CfoI	GCGC	2 cut(s)	140, 175
Cfr13I	GGNCC	1 cut(s)	21
ClaI	ATCGAT	1 cut(s)	427
CseI	GACGC	1 cut(s)	448
Csp6I	GTAC	6 cut(s)	228, 538, 583, 607, 625, 764
CviAII	CATG	4 cut(s)	66, 445, 713, 806
CviJI	RGCY	5 cut(s)	23, 48, 311, 639, 681
CviKI_1	RGCY	5 cut(s)	23, 48, 311, 639, 681
CviQI	GTAC	6 cut(s)	228, 538, 583, 607, 625, 764
DdeI	CTNAG	1 cut(s)	789
DpnI	GATC	4 cut(s)	74, 422, 669, 786
DpnII	GATC	4 cut(s)	72, 420, 667, 784
DraI	TTTAAA	1 cut(s)	742
Eam1104I	CTCTTC	1 cut(s)	200
EarI	CTCTTC	1 cut(s)	200
Eco24I	GRGCYC	1 cut(s)	641
Eco31I	GGTCTC	1 cut(s)	278
EcoT38I	GRGCYC	1 cut(s)	641
FaeI	CATG	4 cut(s)	69, 448, 716, 809
FatI	CATG	4 cut(s)	65, 444, 712, 805
FauNDI	CATATG	1 cut(s)	460
FbaI	TGATCA	1 cut(s)	420
FblI	GTMKAC	1 cut(s)	437
FokI	GGATG	2 cut(s)	158, 565
FriOI	GRGCYC	1 cut(s)	641
FspBI	CTAG	2 cut(s)	281, 717
GlaI	GCGC	2 cut(s)	139, 174
GsuI	CTGGAG	1 cut(s)	149
HaeII	RGCGCY	1 cut(s)	141
HaeIII	GGCC	1 cut(s)	23
HgaI	GACGC	1 cut(s)	448
HhaI	GCGC	2 cut(s)	140, 175
Hin1II	CATG	4 cut(s)	69, 448, 716, 809
Hin6I	GCGC	2 cut(s)	138, 173
HinP1I	GCGC	2 cut(s)	138, 173
HincII	GTYRAC	1 cut(s)	438
HindII	GTYRAC	1 cut(s)	438
HindIII	AAGCTT	1 cut(s)	46
HinfI	GANTC	5 cut(s)	54, 434, 488, 532, 619
Hpy166II	GTNNAC	1 cut(s)	438
Hpy188I	TCNGA	6 cut(s)	113, 364, 387, 487, 493, 792
Hpy188III	TCNNGA	6 cut(s)	220, 397, 412, 597, 671, 831
Hpy8I	GTNNAC	1 cut(s)	438
Hpy99I	CGWCG	1 cut(s)	442
HpyAV	CCTTC	1 cut(s)	308
HpyCH4III	ACNGT	2 cut(s)	106, 253
HpyCH4IV	ACGT	5 cut(s)	168, 545, 627, 734, 766
HpyCH4V	TGCA	2 cut(s)	448, 655
HpyF3I	CTNAG	1 cut(s)	789
HpySE526I	ACGT	5 cut(s)	168, 545, 627, 734, 766
Hsp92II	CATG	4 cut(s)	69, 448, 716, 809
HspAI	GCGC	2 cut(s)	138, 173
Ksp22I	TGATCA	1 cut(s)	420
Kzo9I	GATC	4 cut(s)	72, 420, 667, 784
LmnI	GCTCC	3 cut(s)	41, 130, 686
LpnPI	CCDG	8 cut(s)	113, 142, 225, 233, 501, 526, 710, 715
MaeI	CTAG	2 cut(s)	281, 717
MaeII	ACGT	5 cut(s)	168, 545, 627, 734, 766
MaeIII	GTNAC	1 cut(s)	100
MalI	GATC	4 cut(s)	74, 422, 669, 786
MboI	GATC	4 cut(s)	72, 420, 667, 784
MflI	RGATCY	1 cut(s)	667
MhlI	GDGCHC	2 cut(s)	575, 641
MluCI	AATT	6 cut(s)	77, 114, 381, 601, 748, 793
MlyI	GAGTC	4 cut(s)	63, 443, 497, 613
MmeI	TCCRAC	2 cut(s)	342, 471
MnlI	CCTC	8 cut(s)	23, 26, 348, 385, 516, 640, 798, 835
MroXI	GAANNNNTTC	2 cut(s)	297, 797
MseI	TTAA	3 cut(s)	588, 693, 741
MspA1I	CMGCKG	1 cut(s)	826
NdeI	CATATG	1 cut(s)	460
NdeII	GATC	4 cut(s)	72, 420, 667, 784
NlaIII	CATG	4 cut(s)	69, 448, 716, 809
NlaIV	GGNNCC	3 cut(s)	333, 455, 682
NmuCI	GTSAC	1 cut(s)	100
NspI	RCATGY	2 cut(s)	448, 716
PaeI	GCATGC	1 cut(s)	716
PdmI	GAANNNNTTC	2 cut(s)	297, 797
PfeI	GAWTC	1 cut(s)	532
Pfl23II	CGTACG	1 cut(s)	624
PflMI	CCANNNNNTGG	1 cut(s)	464
PleI	GAGTC	4 cut(s)	62, 442, 496, 613
PpsI	GAGTC	4 cut(s)	62, 442, 496, 613
Ppu21I	YACGTR	2 cut(s)	628, 767
PspLI	CGTACG	1 cut(s)	624
PspN4I	GGNNCC	3 cut(s)	333, 455, 682
PspPI	GGNCC	1 cut(s)	21
PsuI	RGATCY	1 cut(s)	667
RsaI	GTAC	6 cut(s)	229, 539, 584, 608, 626, 765
RsaNI	GTAC	6 cut(s)	228, 538, 583, 607, 625, 764
SalI	GTCGAC	1 cut(s)	436
SaqAI	TTAA	3 cut(s)	588, 693, 741
Sau3AI	GATC	4 cut(s)	72, 420, 667, 784
Sau96I	GGNCC	1 cut(s)	21
ScaI	AGTACT	2 cut(s)	229, 539
SchI	GAGTC	4 cut(s)	63, 443, 497, 613
SduI	GDGCHC	2 cut(s)	575, 641
SfcI	CTRYAG	1 cut(s)	661
SphI	GCATGC	1 cut(s)	716
Sse9I	AATT	6 cut(s)	77, 114, 381, 601, 748, 793
SsiI	CCGC	1 cut(s)	824
SspMI	CTAG	2 cut(s)	281, 717
TaaI	ACNGT	2 cut(s)	106, 253
TaiI	ACGT	5 cut(s)	171, 548, 630, 737, 769
TaqI	TCGA	6 cut(s)	404, 411, 427, 437, 596, 830
TasI	AATT	6 cut(s)	77, 114, 381, 601, 748, 793
TatI	WGTACW	2 cut(s)	227, 537
TfiI	GAWTC	1 cut(s)	532
Tru1I	TTAA	3 cut(s)	588, 693, 741
Tru9I	TTAA	3 cut(s)	588, 693, 741
TscAI	CASTG	2 cut(s)	109, 132
TseFI	GTSAC	1 cut(s)	100
Tsp45I	GTSAC	1 cut(s)	100
TspDTI	ATGAA	4 cut(s)	54, 187, 488, 822
TspGWI	ACGGA	4 cut(s)	158, 344, 612, 624
TspRI	CASTG	2 cut(s)	109, 132
Van91I	CCANNNNNTGG	1 cut(s)	464
XapI	RAATTY	2 cut(s)	601, 793
XceI	RCATGY	2 cut(s)	448, 716
XmiI	GTMKAC	1 cut(s)	437
XmnI	GAANNNNTTC	2 cut(s)	297, 797
XspI	CTAG	2 cut(s)	281, 717
ZrmI	AGTACT	2 cut(s)	229, 539

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.