Rmu_sc0003834.1_g000013

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003834.1
OG0000956
Physical Location & Seq
Forward (+)
43984 .. 44358
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003834.1_g000013.1.cds

Sequence Viewer

Length: 375 bp
atgtgtgcaaaacagcatggtttacacatgagaatccgaagtggtggccacgactacgagggcttatccttcatatcatacatttcaaatacctcttatatagtccttgacttgttttaccttcgagagattgatgttaacatcgcagatgaaagtgcttgggttggatctggagctattgttggagaactatactatagcattgcagaaaaaagcaaagttcatgcatttcctgggggagtttgcccaagtgttggtgtcggtggcctttttagtggtggtgggtacggtcctactatgagaaaatttgggcttacagtggacaacatagtagatgctagactagtcaatgtgaatgcatggtacaatccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BBE FAD_binding_4

Protein Analysis

124

Amino Acids

13.44

Weight (kDa)

6.02

Isoelectric Point (pI)

24.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 254
AclWI GGATC 1 cut(s) 175
AcoI YGGCCR 1 cut(s) 46
AcsI RAATTY 1 cut(s) 305
AfaI GTAC 2 cut(s) 287, 365
AfiI CCNNNNNNNGG 1 cut(s) 254
AgsI TTSAA 1 cut(s) 87
AhlI ACTAGT 1 cut(s) 343
AjnI CCWGG 1 cut(s) 232
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
AlwI GGATC 1 cut(s) 175
AoxI GGCC 2 cut(s) 46, 265
ApoI RAATTY 1 cut(s) 305
AspS9I GGNCC 1 cut(s) 290
AvaII GGWCC 1 cut(s) 290
BalI TGGCCA 1 cut(s) 48
BciT130I CCWGG 1 cut(s) 234
BcuI ACTAGT 1 cut(s) 343
BfaI CTAG 2 cut(s) 339, 344
BfmI CTRYAG 1 cut(s) 196
Bme1390I CCNGG 1 cut(s) 234
Bme18I GGWCC 1 cut(s) 290
BmgT120I GGNCC 1 cut(s) 290
BmrFI CCNGG 1 cut(s) 234
BmsI GCATC 1 cut(s) 325
BpmI CTGGAG 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 233
BsaXI ACNNNNNCTCC 2 cut(s) 165, 195
Bsc4I CCNNNNNNNGG 1 cut(s) 254
Bse3DI GCAATG 1 cut(s) 201
BseBI CCWGG 1 cut(s) 234
BseDI CCNNGG 1 cut(s) 233
BseLI CCNNNNNNNGG 1 cut(s) 254
BseMI GCAATG 1 cut(s) 201
BshFI GGCC 2 cut(s) 48, 267
BslI CCNNNNNNNGG 1 cut(s) 254
BsmI GAATGC 1 cut(s) 361
BsnI GGCC 2 cut(s) 48, 267
Bsp143I GATC 1 cut(s) 167
BspANI GGCC 2 cut(s) 48, 267
BspPI GGATC 1 cut(s) 175
BsrDI GCAATG 1 cut(s) 201
BssECI CCNNGG 1 cut(s) 233
BssMI GATC 1 cut(s) 167
Bst2UI CCWGG 1 cut(s) 234
Bst4CI ACNGT 2 cut(s) 290, 319
BstKTI GATC 1 cut(s) 170
BstMBI GATC 1 cut(s) 167
BstNI CCWGG 1 cut(s) 234
BstSCI CCNGG 1 cut(s) 232
BstSFI CTRYAG 1 cut(s) 196
BstX2I RGATCY 1 cut(s) 167
BstYI RGATCY 1 cut(s) 167
BsuRI GGCC 2 cut(s) 48, 267
BtgZI GCGATG 1 cut(s) 127
BtsIMutI CAGTG 1 cut(s) 324
Cfr13I GGNCC 1 cut(s) 290
Csp6I GTAC 2 cut(s) 286, 364
CviAII CATG 4 cut(s) 17, 28, 224, 360
CviJI RGCY 5 cut(s) 48, 63, 176, 267, 313
CviKI_1 RGCY 5 cut(s) 48, 63, 176, 267, 313
CviQI GTAC 2 cut(s) 286, 364
DpnI GATC 1 cut(s) 169
DpnII GATC 1 cut(s) 167
EaeI YGGCCR 1 cut(s) 46
Eco47I GGWCC 1 cut(s) 290
EcoRII CCWGG 1 cut(s) 232
EcoT22I ATGCAT 2 cut(s) 229, 361
FaeI CATG 4 cut(s) 20, 31, 227, 363
FatI CATG 4 cut(s) 16, 27, 223, 359
FspBI CTAG 2 cut(s) 339, 344
GsuI CTGGAG 1 cut(s) 192
HaeIII GGCC 2 cut(s) 48, 267
Hin1II CATG 4 cut(s) 20, 31, 227, 363
HincII GTYRAC 1 cut(s) 139
HindII GTYRAC 1 cut(s) 139
HinfI GANTC 1 cut(s) 33
HpaI GTTAAC 1 cut(s) 139
Hpy166II GTNNAC 3 cut(s) 23, 139, 322
Hpy188I TCNGA 1 cut(s) 38
Hpy188III TCNNGA 2 cut(s) 125, 171
Hpy8I GTNNAC 3 cut(s) 23, 139, 322
HpyAV CCTTC 2 cut(s) 79, 131
HpyCH4III ACNGT 2 cut(s) 290, 319
HpyCH4V TGCA 4 cut(s) 8, 206, 227, 359
Hsp92II CATG 4 cut(s) 20, 31, 227, 363
KspAI GTTAAC 1 cut(s) 139
Kzo9I GATC 1 cut(s) 167
LmnI GCTCC 1 cut(s) 173
LpnPI CCDG 3 cut(s) 156, 219, 246
LweI GCATC 1 cut(s) 325
MaeI CTAG 2 cut(s) 339, 344
MalI GATC 1 cut(s) 169
MboI GATC 1 cut(s) 167
MflI RGATCY 1 cut(s) 167
MlsI TGGCCA 1 cut(s) 48
MluCI AATT 1 cut(s) 305
MluNI TGGCCA 1 cut(s) 48
MmeI TCCRAC 2 cut(s) 145, 163
MnlI CCTC 2 cut(s) 52, 103
Mox20I TGGCCA 1 cut(s) 48
Mph1103I ATGCAT 2 cut(s) 229, 361
MscI TGGCCA 1 cut(s) 48
MseI TTAA 1 cut(s) 138
Msp20I TGGCCA 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 234
Mva1269I GAATGC 1 cut(s) 361
MvaI CCWGG 1 cut(s) 234
NdeII GATC 1 cut(s) 167
NlaIII CATG 4 cut(s) 20, 31, 227, 363
NsiI ATGCAT 2 cut(s) 229, 361
PctI GAATGC 1 cut(s) 361
PfeI GAWTC 1 cut(s) 33
PflMI CCANNNNNTGG 1 cut(s) 254
Psp6I CCWGG 1 cut(s) 232
PspGI CCWGG 1 cut(s) 232
PspPI GGNCC 1 cut(s) 290
PsuI RGATCY 1 cut(s) 167
RsaI GTAC 2 cut(s) 287, 365
RsaNI GTAC 2 cut(s) 286, 364
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 1 cut(s) 167
Sau96I GGNCC 1 cut(s) 290
ScrFI CCNGG 1 cut(s) 234
SetI ASST 3 cut(s) 95, 123, 178
SfaNI GCATC 1 cut(s) 325
SfcI CTRYAG 1 cut(s) 196
SinI GGWCC 1 cut(s) 290
SpeI ACTAGT 1 cut(s) 343
Sse9I AATT 1 cut(s) 305
SspMI CTAG 2 cut(s) 339, 344
StyD4I CCNGG 1 cut(s) 232
TaaI ACNGT 2 cut(s) 290, 319
TaqI TCGA 1 cut(s) 124
TasI AATT 1 cut(s) 305
TfiI GAWTC 1 cut(s) 33
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 324
TspDTI ATGAA 3 cut(s) 61, 165, 212
TspRI CASTG 1 cut(s) 324
Van91I CCANNNNNTGG 1 cut(s) 254
VpaK11BI GGWCC 1 cut(s) 290
XapI RAATTY 1 cut(s) 305
XspI CTAG 2 cut(s) 339, 344
Zsp2I ATGCAT 2 cut(s) 229, 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.