Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005929.1

Orthogroup ID

OG0000956

Physical Location & Seq

Genomic Coordinates Forward (+)

26448 .. 27140

Gene Structure 693 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005929.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 693 bp

atgcctcaagtattgaatactagtttgggtaacaagactgtggaagtgtcattcattggtttcttcttgggacaaagtgataagcttctttcattgataaataggagtcttcctgaattggatttgcagaaaacagattgctatgaaatgagttgggtagaatctacggtattttgggctaattacccagttggaacttccatagacgttctacttgaaagggctaaggggccaacagacaacttcaaaggcaagtctgactacgtgaaagaaccaattccaaaacaagacagagaattcatattgaaggagctacttaagatggaaaacttgtggatgcaatggaacccttatagtggaagaatgagtgagatttctgagtcggaaactcccttccctcacagagccggaaacctgtttttgattcaatactcttcgtcgtgggaggaagaagggattgaggctaccaacaagtaccttagcttatctagaaaattttacaaaataatgactccatttgtatccaagggaccaagagaggccttccaaaactacagagatcttgacattggggccaatttggataatcatgttgagaatatatgtcatcccacatgggaaaaatgggaccttgcctatgggtttataagagtttgggccactccatccattgccaattggttttggatataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BBE FAD_binding_4

Protein Analysis

230

Amino Acids

26.81

Weight (kDa)

5.22

Isoelectric Point (pI)

40.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000956)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G26380 AT1G26390 AT1G26400 AT1G26410 AT1G26420 AT4G20800
fragaria_vesca	FvH4_3g11042 FvH4_3g11043 FvH4_3g11044 FvH4_3g11090
malus_domestica	MD05G1266700.v1.1 MD05G1266800.v1.1 MD05G1267200.v1.1 MD05G1267300.v1.1 MD10G1243900.v1.1 MD10G1244000.v1.1
prunus_persica	Prupe.1G032800_v2.0.a1 Prupe.4G092300_v2.0.a1 Prupe.4G098500_v2.0.a1 Prupe.4G098600_v2.0.a1 Prupe.4G098700_v2.0.a1 Prupe.4G098900_v2.0.a1 Prupe.4G099000_v2.0.a1 Prupe.4G099100_v2.0.a1 Prupe.4G099200_v2.0.a1 Prupe.4G099400_v2.0.a1 Prupe.4G230400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0017771 RchiOBHm_Chr5g0017801 RchiOBHm_Chr5g0017831 RchiOBHm_Chr5g0017861 RchiOBHm_Chr5g0017931 RchiOBHm_Chr5g0017951 RchiOBHm_Chr5g0017981
rosa_laevigata	RLG00000032314 RLG00000032315 RLG00000032316 RLG00000032324 RLG00000032325 RLG00000032328 RLG00000032349
rosa_multiflora	Rmu_sc0003375.1_g000007 Rmu_sc0003834.1_g000007 Rmu_sc0003834.1_g000013 Rmu_sc0003834.1_g000014 Rmu_sc0005929.1_g000010 Rmu_sc0005929.1_g000016 Rmu_sc0011118.1_g000003 Rmu_sc0011171.1_g000007 Rmu_sc0013814.1_g000002 Rmu_sc0014753.1_g000007
rosa_roxburghii	Rroxscaffold_1G00059450 Rroxscaffold_1G00059620 Rroxscaffold_1G00059700 Rroxscaffold_1G00059710
rosa_rugosa	Rorug05G0038600 Rorug05G0038700 Rorug05G0038900 Rorug05G0039200 Rorug05G0039300
rosa_wichuraiana	Rw5G011460 Rw5G011500 Rw5G011520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	647
AcsI	RAATTY	2 cut(s)	296, 494
AfaI	GTAC	1 cut(s)	476
AfiI	CCNNNNNNNGG	1 cut(s)	356
AflII	CTTAAG	1 cut(s)	317
AgsI	TTSAA	5 cut(s)	16, 218, 247, 307, 428
AhlI	ACTAGT	1 cut(s)	20
AjuI	GAANNNNNNNTTGG	2 cut(s)	8, 40
AluBI	AGCT	3 cut(s)	85, 313, 483
AluI	AGCT	3 cut(s)	85, 313, 483
AoxI	GGCC	4 cut(s)	230, 540, 573, 657
ApoI	RAATTY	2 cut(s)	296, 494
Asp700I	GAANNNNTTC	1 cut(s)	276
AspS9I	GGNCC	5 cut(s)	230, 530, 573, 628, 657
AvaII	GGWCC	2 cut(s)	530, 628
BbsI	GAAGAC	1 cut(s)	101
BccI	CCATC	2 cut(s)	316, 673
BciVI	GTATCC	1 cut(s)	532
BcuI	ACTAGT	1 cut(s)	20
BfaI	CTAG	2 cut(s)	21, 489
BfmI	CTRYAG	1 cut(s)	553
BfrI	CTTAAG	1 cut(s)	317
BfuI	GTATCC	1 cut(s)	532
BglII	AGATCT	1 cut(s)	559
Bme18I	GGWCC	2 cut(s)	530, 628
BmgT120I	GGNCC	5 cut(s)	230, 530, 573, 628, 657
BmiI	GGNNCC	5 cut(s)	231, 347, 531, 574, 629
BmrI	ACTGGG	1 cut(s)	182
BmsI	GCATC	1 cut(s)	327
BmuI	ACTGGG	1 cut(s)	182
BpiI	GAAGAC	1 cut(s)	101
Bpu10I	CCTNAGC	2 cut(s)	225, 479
BsaAI	YACGTR	1 cut(s)	265
BsaJI	CCNNGG	1 cut(s)	525
Bsc4I	CCNNNNNNNGG	1 cut(s)	356
Bse1I	ACTGG	1 cut(s)	188
Bse3DI	GCAATG	2 cut(s)	347, 669
BseDI	CCNNGG	1 cut(s)	525
BseGI	GGATG	3 cut(s)	342, 607, 665
BseLI	CCNNNNNNNGG	1 cut(s)	356
BseMI	GCAATG	2 cut(s)	347, 669
BseMII	CTCAG	1 cut(s)	369
BseNI	ACTGG	1 cut(s)	188
BshFI	GGCC	4 cut(s)	232, 542, 575, 659
BsiSI	CCGG	1 cut(s)	408
BslFI	GGGAC	3 cut(s)	84, 543, 641
BslI	CCNNNNNNNGG	1 cut(s)	356
BsmFI	GGGAC	3 cut(s)	84, 543, 641
BsnI	GGCC	4 cut(s)	232, 542, 575, 659
Bsp143I	GATC	1 cut(s)	559
BspANI	GGCC	4 cut(s)	232, 542, 575, 659
BspCNI	CTCAG	1 cut(s)	370
BspLI	GGNNCC	5 cut(s)	231, 347, 531, 574, 629
BspTI	CTTAAG	1 cut(s)	317
BsrDI	GCAATG	2 cut(s)	347, 669
BsrI	ACTGG	1 cut(s)	188
BssECI	CCNNGG	1 cut(s)	525
BssMI	GATC	1 cut(s)	559
BssT1I	CCWWGG	1 cut(s)	525
Bst4CI	ACNGT	2 cut(s)	40, 169
Bst6I	CTCTTC	1 cut(s)	439
BstAFI	CTTAAG	1 cut(s)	317
BstBAI	YACGTR	1 cut(s)	265
BstDEI	CTNAG	3 cut(s)	225, 378, 479
BstF5I	GGATG	3 cut(s)	342, 607, 665
BstKTI	GATC	1 cut(s)	562
BstMBI	GATC	1 cut(s)	559
BstSFI	CTRYAG	1 cut(s)	553
BstV2I	GAAGAC	1 cut(s)	101
BstX2I	RGATCY	1 cut(s)	559
BstYI	RGATCY	1 cut(s)	559
BsuI	GTATCC	1 cut(s)	532
BsuRI	GGCC	4 cut(s)	232, 542, 575, 659
BtsCI	GGATG	3 cut(s)	342, 607, 665
Cfr13I	GGNCC	5 cut(s)	230, 530, 573, 628, 657
Csp6I	GTAC	1 cut(s)	475
CviAII	CATG	2 cut(s)	590, 615
CviQI	GTAC	1 cut(s)	475
DdeI	CTNAG	3 cut(s)	225, 378, 479
DpnI	GATC	1 cut(s)	561
DpnII	GATC	1 cut(s)	559
Eam1104I	CTCTTC	1 cut(s)	439
EarI	CTCTTC	1 cut(s)	439
Eco130I	CCWWGG	1 cut(s)	525
Eco147I	AGGCCT	1 cut(s)	542
Eco47I	GGWCC	2 cut(s)	530, 628
EcoO109I	RGGNCCY	1 cut(s)	628
EcoRI	GAATTC	1 cut(s)	296
EcoT14I	CCWWGG	1 cut(s)	525
ErhI	CCWWGG	1 cut(s)	525
FaeI	CATG	2 cut(s)	593, 618
FaqI	GGGAC	3 cut(s)	84, 543, 641
FatI	CATG	2 cut(s)	589, 614
FokI	GGATG	3 cut(s)	349, 594, 652
FspBI	CTAG	2 cut(s)	21, 489
HaeIII	GGCC	4 cut(s)	232, 542, 575, 659
HapII	CCGG	1 cut(s)	408
Hin1II	CATG	2 cut(s)	593, 618
HindIII	AAGCTT	1 cut(s)	83
HinfI	GANTC	5 cut(s)	106, 161, 380, 424, 511
HpaII	CCGG	1 cut(s)	408
Hpy188I	TCNGA	3 cut(s)	259, 379, 385
Hpy188III	TCNNGA	3 cut(s)	113, 489, 563
Hpy99I	CGWCG	1 cut(s)	442
HpyAV	CCTTC	4 cut(s)	301, 403, 446, 553
HpyCH4III	ACNGT	2 cut(s)	40, 169
HpyCH4IV	ACGT	2 cut(s)	207, 264
HpyCH4V	TGCA	2 cut(s)	127, 340
HpyF3I	CTNAG	3 cut(s)	225, 378, 479
HpySE526I	ACGT	2 cut(s)	207, 264
Hsp92II	CATG	2 cut(s)	593, 618
Kzo9I	GATC	1 cut(s)	559
LmnI	GCTCC	1 cut(s)	310
LpnPI	CCDG	4 cut(s)	126, 201, 421, 428
LweI	GCATC	1 cut(s)	327
MaeI	CTAG	2 cut(s)	21, 489
MaeII	ACGT	2 cut(s)	207, 264
MaeIII	GTNAC	1 cut(s)	29
MalI	GATC	1 cut(s)	561
MboI	GATC	1 cut(s)	559
MboII	GAAGA	5 cut(s)	55, 101, 372, 426, 461
MfeI	CAATTG	1 cut(s)	676
MflI	RGATCY	1 cut(s)	559
MluCI	AATT	7 cut(s)	116, 181, 276, 296, 494, 577, 676
MlyI	GAGTC	3 cut(s)	115, 389, 505
MmeI	TCCRAC	2 cut(s)	172, 363
MnlI	CCTC	5 cut(s)	15, 408, 439, 454, 532
MroXI	GAANNNNTTC	1 cut(s)	276
MseI	TTAA	1 cut(s)	318
MspCI	CTTAAG	1 cut(s)	317
MspI	CCGG	1 cut(s)	408
MunI	CAATTG	1 cut(s)	676
NdeII	GATC	1 cut(s)	559
NlaIII	CATG	2 cut(s)	593, 618
NlaIV	GGNNCC	5 cut(s)	231, 347, 531, 574, 629
PceI	AGGCCT	1 cut(s)	542
PdmI	GAANNNNTTC	1 cut(s)	276
PfeI	GAWTC	2 cut(s)	161, 424
PleI	GAGTC	3 cut(s)	114, 388, 505
PpsI	GAGTC	3 cut(s)	114, 388, 505
Ppu21I	YACGTR	1 cut(s)	265
PpuMI	RGGWCCY	1 cut(s)	628
PsiI	TTATAA	1 cut(s)	647
Psp5II	RGGWCCY	1 cut(s)	628
PspN4I	GGNNCC	5 cut(s)	231, 347, 531, 574, 629
PspPI	GGNCC	5 cut(s)	230, 530, 573, 628, 657
PspPPI	RGGWCCY	1 cut(s)	628
PsuI	RGATCY	1 cut(s)	559
RsaI	GTAC	1 cut(s)	476
RsaNI	GTAC	1 cut(s)	475
SaqAI	TTAA	1 cut(s)	318
Sau3AI	GATC	1 cut(s)	559
Sau96I	GGNCC	5 cut(s)	230, 530, 573, 628, 657
SchI	GAGTC	3 cut(s)	115, 389, 505
SetI	ASST	8 cut(s)	87, 210, 267, 315, 417, 480, 485, 633
SfaNI	GCATC	1 cut(s)	327
SfcI	CTRYAG	1 cut(s)	553
SinI	GGWCC	2 cut(s)	530, 628
SmlI	CTYRAG	2 cut(s)	6, 317
SmoI	CTYRAG	2 cut(s)	6, 317
SpeI	ACTAGT	1 cut(s)	20
Sse9I	AATT	7 cut(s)	116, 181, 276, 296, 494, 577, 676
SseBI	AGGCCT	1 cut(s)	542
SspMI	CTAG	2 cut(s)	21, 489
StuI	AGGCCT	1 cut(s)	542
StyI	CCWWGG	1 cut(s)	525
TaaI	ACNGT	2 cut(s)	40, 169
TaiI	ACGT	2 cut(s)	210, 267
TasI	AATT	7 cut(s)	116, 181, 276, 296, 494, 577, 676
TfiI	GAWTC	2 cut(s)	161, 424
Tru1I	TTAA	1 cut(s)	318
Tru9I	TTAA	1 cut(s)	318
TspDTI	ATGAA	4 cut(s)	43, 81, 159, 289
Vha464I	CTTAAG	1 cut(s)	317
VpaK11BI	GGWCC	2 cut(s)	530, 628
XapI	RAATTY	2 cut(s)	296, 494
XbaI	TCTAGA	1 cut(s)	488
XmnI	GAANNNNTTC	1 cut(s)	276
XspI	CTAG	2 cut(s)	21, 489

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.