Rroxscaffold_2G00141650

Transcription elongation factor B polypeptide

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000297
Physical Location & Seq
Reverse (-)
79858268 .. 79858600
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00141650.1

Sequence Viewer

Length: 333 bp
ATGGAGAAAGGAAGGTTAATCCGTCTCAACGGTCACTGGGTCTCCATCGCTATAGACAATCTTGATTCTTTTGGGGATGTTGGCTACCTAGACTTCAGGTTTCTCGATCAACTCTTACCCCACTGCTCCAAAGATCAGTTGATTCACATCGAGAAGAGCACAAAAGATGTAGACCTGACTCCGATCACTGATAAGCTGTGGAAGAGGTTCTTCGAGAAAGACTTCGGTGGCAAAGCCACCGATGAGGTGATCCAGAAGATGAAGATCAAGAAAATGAGTTTCAAGTGGTCGGAGTTGTACGAGGCCAAGTCGAAGAGGATGAGAAAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Elongin_A

Protein Analysis

110

Amino Acids

13.05

Weight (kDa)

9.46

Isoelectric Point (pI)

29.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Elongin_A PF06881 25 - 109 2.6e-17 RNA polymerase II transcription factor SIII (Elongin) subunit A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000297)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G42780 AT2G42780
fragaria_vesca FvH4_6g37640 FvH4_6g37640 FvH4_7g18970 FvH4_7g19430 FvH4_7g20490
malus_domestica MD04G1219900.v1.1 MD09G1156600.v1.1 MD11G1064800.v1.1 MD17G1143100.v1.1
prunus_persica Prupe.3G169700_v2.0.a1 Prupe.3G169700_v2.0.a1 Prupe.3G169700_v2.0.a1 Prupe.3G169700_v2.0.a1
pyrus_communis pycom09g07530 pycom11g05390 pycom12g21760 pycom17g13620
rosa_chinensis RchiOBHm_Chr1g0363261 RchiOBHm_Chr1g0363291 RchiOBHm_Chr1g0363311 RchiOBHm_Chr1g0363471 RchiOBHm_Chr1g0363891 RchiOBHm_Chr1g0377321 RchiOBHm_Chr2g0097481 RchiOBHm_Chr2g0101011 RchiOBHm_Chr2g0137701 RchiOBHm_Chr2g0150641 RchiOBHm_Chr2g0150701 RchiOBHm_Chr3g0476421 RchiOBHm_Chr5g0057921 RchiOBHm_Chr5g0057931 RchiOBHm_Chr5g0057951 RchiOBHm_Chr5g0057981 RchiOBHm_Chr5g0058001 RchiOBHm_Chr5g0058031 RchiOBHm_Chr5g0058051 RchiOBHm_Chr5g0058081 RchiOBHm_Chr5g0058101
rosa_laevigata RLG00000017036 RLG00000019670 RLG00000020502 RLG00000023768 RLG00000027563 RLG00000027575 RLG00000027577 RLG00000027578 RLG00000034860 RLG00000035193
rosa_multiflora Rmu_co8175074.1_g000001 Rmu_sc0000367.1_g000008 Rmu_sc0001862.1_g000004 Rmu_sc0001944.1_g000004 Rmu_sc0002483.1_g000004 Rmu_sc0004027.1_g000010 Rmu_sc0004458.1_g000001 Rmu_sc0004556.1_g000009 Rmu_sc0007226.1_g000008 Rmu_sc0011095.1_g000003 Rmu_sc0027954.1_g000002 Rmu_sc0028722.1_g000001
rosa_roxburghii Rroxscaffold_1G00022510 Rroxscaffold_1G00028200 Rroxscaffold_2G00097050 Rroxscaffold_2G00106910 Rroxscaffold_2G00106930 Rroxscaffold_2G00141650 Rroxscaffold_4G00293150 Rroxscaffold_4G00293320 Rroxscaffold_6G00405280
rosa_rugosa Rorug01G0305900 Rorug01G0306000 Rorug01G0306200 Rorug01G0307100 Rorug01G0307100 Rorug01G0307200 Rorug01G0310800 Rorug01G0402700 Rorug02G0095200 Rorug02G0344100.1 Rorug02G0421900 Rorug02G0422000 Rorug02G0422100 Rorug02G0422200 Rorug03G0154300 Rorug05G0310800 Rorug05G0310900 Rorug05G0337400
rosa_samantha Rh1AG314800 Rh1AG315000 Rh1AG316200 Rh1AG318700 Rh1AG420300 Rh1DG309100 Rh1DG309300 Rh1DG310600 Rh1DG313200 Rh1DG410200 Rh2AG142500 Rh2AG392100 Rh2AG481600 Rh2BG147600 Rh2BG399400 Rh2BG399600 Rh2BG493800 Rh2DG502800 Rh3BG237100 Rh3CG231600 Rh5BG390600 Rh5DG405200
rosa_wichuraiana Rw1G027900 Rw1G027910 Rw1G028000 Rw1G036850 Rw2G011180 Rw2G032110 Rw2G032120 Rw2G039370 Rw2G039510 Rw3G018680 Rw5G035730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 171
AclWI GGATC 1 cut(s) 244
AcuI CTGAAG 1 cut(s) 79
AfaI GTAC 1 cut(s) 299
AgsI TTSAA 1 cut(s) 283
AluBI AGCT 1 cut(s) 196
AluI AGCT 1 cut(s) 196
Alw21I GWGCWC 1 cut(s) 161
Alw26I GTCTC 2 cut(s) 29, 46
AlwI GGATC 1 cut(s) 244
AoxI GGCC 1 cut(s) 303
Asp700I GAANNNNTTC 2 cut(s) 206, 221
AsuHPI GGTGA 1 cut(s) 259
Bbv12I GWGCWC 1 cut(s) 161
BccI CCATC 1 cut(s) 53
BcoDI GTCTC 2 cut(s) 29, 46
BfaI CTAG 1 cut(s) 89
BfmI CTRYAG 1 cut(s) 51
BmrI ACTGGG 1 cut(s) 46
BmuI ACTGGG 1 cut(s) 46
BsaBI GATNNNNATC 2 cut(s) 146, 263
BsaI GGTCTC 1 cut(s) 46
BsaXI ACNNNNNCTCC 2 cut(s) 26, 56
Bse1I ACTGG 1 cut(s) 41
Bse8I GATNNNNATC 2 cut(s) 146, 263
BseGI GGATG 2 cut(s) 82, 324
BseJI GATNNNNATC 2 cut(s) 146, 263
BseNI ACTGG 1 cut(s) 41
BshFI GGCC 1 cut(s) 305
BsiHKAI GWGCWC 1 cut(s) 161
BsmAI GTCTC 2 cut(s) 29, 46
BsmBI CGTCTC 1 cut(s) 29
BsnI GGCC 1 cut(s) 305
Bso31I GGTCTC 1 cut(s) 46
Bsp1286I GDGCHC 1 cut(s) 161
Bsp143I GATC 5 cut(s) 106, 133, 183, 249, 264
BspANI GGCC 1 cut(s) 305
BspPI GGATC 1 cut(s) 244
BspQI GCTCTTC 1 cut(s) 149
BspTNI GGTCTC 1 cut(s) 46
BsrI ACTGG 1 cut(s) 41
BssMI GATC 5 cut(s) 106, 133, 183, 249, 264
Bst4CI ACNGT 1 cut(s) 32
Bst6I CTCTTC 3 cut(s) 149, 197, 308
BstF5I GGATG 2 cut(s) 82, 324
BstKTI GATC 5 cut(s) 109, 136, 186, 252, 267
BstMAI GTCTC 2 cut(s) 29, 46
BstMBI GATC 5 cut(s) 106, 133, 183, 249, 264
BstSFI CTRYAG 1 cut(s) 51
BsuRI GGCC 1 cut(s) 305
BtgZI GCGATG 1 cut(s) 31
BtsCI GGATG 2 cut(s) 82, 324
BtsI GCAGTG 1 cut(s) 121
BtsIMutI CAGTG 3 cut(s) 34, 121, 186
Csp6I GTAC 1 cut(s) 298
CviJI RGCY 4 cut(s) 84, 196, 236, 305
CviKI_1 RGCY 4 cut(s) 84, 196, 236, 305
CviQI GTAC 1 cut(s) 298
DpnI GATC 5 cut(s) 108, 135, 185, 251, 266
DpnII GATC 5 cut(s) 106, 133, 183, 249, 264
Eam1104I CTCTTC 3 cut(s) 149, 197, 308
EarI CTCTTC 3 cut(s) 149, 197, 308
Eco31I GGTCTC 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 79
Esp3I CGTCTC 1 cut(s) 29
FaiI YATR 1 cut(s) 53
FalI AAGNNNNNCTT 2 cut(s) 194, 226
FblI GTMKAC 1 cut(s) 171
FokI GGATG 1 cut(s) 89
FspBI CTAG 1 cut(s) 89
HaeIII GGCC 1 cut(s) 305
HinfI GANTC 3 cut(s) 65, 142, 178
HphI GGTGA 1 cut(s) 259
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 2 cut(s) 183, 292
Hpy188III TCNNGA 6 cut(s) 62, 104, 151, 214, 253, 268
Hpy8I GTNNAC 1 cut(s) 172
HpyAV CCTTC 1 cut(s) 6
HpyCH4III ACNGT 1 cut(s) 32
Kzo9I GATC 5 cut(s) 106, 133, 183, 249, 264
LguI GCTCTTC 1 cut(s) 149
LmnI GCTCC 1 cut(s) 131
LpnPI CCDG 4 cut(s) 22, 82, 188, 266
MaeI CTAG 1 cut(s) 89
MaeIII GTNAC 1 cut(s) 32
MalI GATC 5 cut(s) 108, 135, 185, 251, 266
MboI GATC 5 cut(s) 106, 133, 183, 249, 264
MboII GAAGA 6 cut(s) 166, 202, 214, 268, 274, 325
MhlI GDGCHC 1 cut(s) 161
MlyI GAGTC 1 cut(s) 172
MmeI TCCRAC 1 cut(s) 270
MnlI CCTC 4 cut(s) 198, 238, 295, 309
MroXI GAANNNNTTC 2 cut(s) 206, 221
MseI TTAA 1 cut(s) 17
NdeII GATC 5 cut(s) 106, 133, 183, 249, 264
NmuCI GTSAC 1 cut(s) 32
PciSI GCTCTTC 1 cut(s) 149
PdmI GAANNNNTTC 2 cut(s) 206, 221
PfeI GAWTC 2 cut(s) 65, 142
PleI GAGTC 1 cut(s) 172
PpsI GAGTC 1 cut(s) 172
RsaI GTAC 1 cut(s) 299
RsaNI GTAC 1 cut(s) 298
SapI GCTCTTC 1 cut(s) 149
SaqAI TTAA 1 cut(s) 17
Sau3AI GATC 5 cut(s) 106, 133, 183, 249, 264
SchI GAGTC 1 cut(s) 172
SduI GDGCHC 1 cut(s) 161
SetI ASST 7 cut(s) 17, 90, 101, 177, 198, 209, 249
SfcI CTRYAG 1 cut(s) 51
SspMI CTAG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 32
TaqI TCGA 4 cut(s) 105, 150, 213, 311
TfiI GAWTC 2 cut(s) 65, 142
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TscAI CASTG 3 cut(s) 41, 128, 193
TseFI GTSAC 1 cut(s) 32
Tsp45I GTSAC 1 cut(s) 32
TspDTI ATGAA 1 cut(s) 275
TspGWI ACGGA 1 cut(s) 11
TspRI CASTG 3 cut(s) 41, 128, 193
XmiI GTMKAC 1 cut(s) 171
XmnI GAANNNNTTC 2 cut(s) 206, 221
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.