Rorug07G0317000
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
32202864 .. 32203043
180 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0317000.1

Sequence Viewer

Length: 180 bp
ATGTCATGTTTTAAACTCAAATTTGAACACTATGTAGTCAAAGCCAATATCTATCTCTATGATCATACTGCAAGTGAGCACCCTAATTTTGCTAACCGTGCATCAAGTCTTCTCAAATCAGTTTCTGAAGTGAAGTATATGTCTCTTTCACCCCATTATTGGAAAGTTAGTATTACTTAA

Protein Analysis

59

Amino Acids

6.9

Weight (kDa)

9.17

Isoelectric Point (pI)

63.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000609)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 20
AcuI CTGAAG 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 159
AgsI TTSAA 1 cut(s) 26
Alw21I GWGCWC 1 cut(s) 81
Alw26I GTCTC 1 cut(s) 147
AlwNI CAGNNNCTG 1 cut(s) 125
ApoI RAATTY 1 cut(s) 20
AsuHPI GGTGA 1 cut(s) 141
BbsI GAAGAC 1 cut(s) 101
Bbv12I GWGCWC 1 cut(s) 81
BclI TGATCA 1 cut(s) 61
BcoDI GTCTC 1 cut(s) 147
BmsI GCATC 1 cut(s) 110
BpiI GAAGAC 1 cut(s) 101
Bsc4I CCNNNNNNNGG 1 cut(s) 159
BseLI CCNNNNNNNGG 1 cut(s) 159
BsiHKAI GWGCWC 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 159
BsmAI GTCTC 1 cut(s) 147
Bsp1286I GDGCHC 1 cut(s) 81
Bsp143I GATC 1 cut(s) 61
BssMI GATC 1 cut(s) 61
Bst4CI ACNGT 1 cut(s) 98
BstKTI GATC 1 cut(s) 64
BstMAI GTCTC 1 cut(s) 147
BstMBI GATC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstV2I GAAGAC 1 cut(s) 101
CaiI CAGNNNCTG 1 cut(s) 125
CviAII CATG 1 cut(s) 6
CviJI RGCY 1 cut(s) 44
CviKI_1 RGCY 1 cut(s) 44
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
DraI TTTAAA 1 cut(s) 13
Eco57I CTGAAG 1 cut(s) 147
FaeI CATG 1 cut(s) 9
FaiI YATR 6 cut(s) 7, 33, 60, 66, 138, 140
FatI CATG 1 cut(s) 5
FbaI TGATCA 1 cut(s) 61
FspEI CC 8 cut(s) 58, 95, 96, 110, 145, 165, 166, 167
Hin1II CATG 1 cut(s) 9
HphI GGTGA 1 cut(s) 141
Hpy188I TCNGA 1 cut(s) 127
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4V TGCA 2 cut(s) 71, 101
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
Hsp92II CATG 1 cut(s) 9
Ksp22I TGATCA 1 cut(s) 61
Kzo9I GATC 1 cut(s) 61
LweI GCATC 1 cut(s) 110
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 101
MhlI GDGCHC 1 cut(s) 81
MluCI AATT 2 cut(s) 20, 85
MseI TTAA 2 cut(s) 12, 178
MwoI GCNNNNNNNGC 1 cut(s) 98
NdeII GATC 1 cut(s) 61
NlaIII CATG 1 cut(s) 9
PstNI CAGNNNCTG 1 cut(s) 125
SaqAI TTAA 2 cut(s) 12, 178
Sau3AI GATC 1 cut(s) 61
SduI GDGCHC 1 cut(s) 81
SfaNI GCATC 1 cut(s) 110
SgeI CNNG 4 cut(s) 18, 84, 110, 117
Sse9I AATT 2 cut(s) 20, 85
TaaI ACNGT 1 cut(s) 98
TasI AATT 2 cut(s) 20, 85
Tru1I TTAA 2 cut(s) 12, 178
Tru9I TTAA 2 cut(s) 12, 178
XapI RAATTY 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.