Rh3AG314000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0001308
Physical Location & Seq
Forward (+)
40105174 .. 40121110
15937 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG314000.1

Sequence Viewer

Length: 249 bp
ATGGTTGAGCTGTGCTTTGTACTCGATTTGAGAGATTCCACCGTCGCCGACTGGGTGCAAATCAGAGTTGCTCGAAGATCTGATAGGCCTGTGCTTCATCTTCAAAAATTTGATCACCTCCTCCGATTGTACTCCCATCACCGTCATCGACACCTCATCCAGGGTCATAAATCAATAAACTCATTGACAACAAAAAAAGGTCCTCACCTGGCCTTGGATTTACTGTTGTTTGAGAGCTTTGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.72

Weight (kDa)

9.51

Isoelectric Point (pI)

45.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 2 cut(s) 21, 131
AfiI CCNNNNNNNGG 2 cut(s) 160, 214
AgsI TTSAA 1 cut(s) 104
AjnI CCWGG 2 cut(s) 159, 207
AluBI AGCT 2 cut(s) 10, 237
AluI AGCT 2 cut(s) 10, 237
AoxI GGCC 2 cut(s) 86, 210
ApoI RAATTY 1 cut(s) 107
AspS9I GGNCC 1 cut(s) 200
AsuHPI GGTGA 3 cut(s) 107, 131, 197
AvaII GGWCC 1 cut(s) 200
BccI CCATC 1 cut(s) 144
BciT130I CCWGG 2 cut(s) 161, 209
BclI TGATCA 1 cut(s) 112
BfaI CTAG 1 cut(s) 247
BglII AGATCT 1 cut(s) 77
Bme1390I CCNGG 2 cut(s) 161, 209
Bme18I GGWCC 1 cut(s) 200
BmgT120I GGNCC 1 cut(s) 200
BmrFI CCNGG 2 cut(s) 161, 209
BmrI ACTGGG 1 cut(s) 61
BmuI ACTGGG 1 cut(s) 61
BsaJI CCNNGG 2 cut(s) 160, 213
Bsc4I CCNNNNNNNGG 2 cut(s) 160, 214
Bse1I ACTGG 1 cut(s) 56
BseBI CCWGG 2 cut(s) 161, 209
BseDI CCNNGG 2 cut(s) 160, 213
BseGI GGATG 1 cut(s) 156
BseLI CCNNNNNNNGG 2 cut(s) 160, 214
BseNI ACTGG 1 cut(s) 56
BseRI GAGGAG 1 cut(s) 110
BshFI GGCC 2 cut(s) 88, 212
BslI CCNNNNNNNGG 2 cut(s) 160, 214
BsnI GGCC 2 cut(s) 88, 212
Bsp143I GATC 2 cut(s) 77, 112
BspANI GGCC 2 cut(s) 88, 212
BsrI ACTGG 1 cut(s) 56
BssECI CCNNGG 2 cut(s) 160, 213
BssMI GATC 2 cut(s) 77, 112
BssT1I CCWWGG 1 cut(s) 213
Bst2UI CCWGG 2 cut(s) 161, 209
Bst4CI ACNGT 3 cut(s) 43, 143, 225
BstENI CCTNNNNNAGG 1 cut(s) 158
BstF5I GGATG 1 cut(s) 156
BstKTI GATC 2 cut(s) 80, 115
BstMBI GATC 2 cut(s) 77, 112
BstNI CCWGG 2 cut(s) 161, 209
BstSCI CCNGG 2 cut(s) 159, 207
BstX2I RGATCY 1 cut(s) 77
BstYI RGATCY 1 cut(s) 77
BsuRI GGCC 2 cut(s) 88, 212
BtsCI GGATG 1 cut(s) 156
Cfr13I GGNCC 1 cut(s) 200
Csp6I GTAC 2 cut(s) 20, 130
CviJI RGCY 4 cut(s) 10, 88, 212, 237
CviKI_1 RGCY 4 cut(s) 10, 88, 212, 237
CviQI GTAC 2 cut(s) 20, 130
DpnI GATC 2 cut(s) 79, 114
DpnII GATC 2 cut(s) 77, 112
Eco130I CCWWGG 1 cut(s) 213
Eco147I AGGCCT 1 cut(s) 88
Eco47I GGWCC 1 cut(s) 200
EcoNI CCTNNNNNAGG 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 200
EcoRII CCWGG 2 cut(s) 159, 207
EcoT14I CCWWGG 1 cut(s) 213
ErhI CCWWGG 1 cut(s) 213
FaiI YATR 1 cut(s) 168
FbaI TGATCA 1 cut(s) 112
FokI GGATG 1 cut(s) 143
FspBI CTAG 1 cut(s) 247
HaeIII GGCC 2 cut(s) 88, 212
HinfI GANTC 1 cut(s) 35
HphI GGTGA 3 cut(s) 107, 131, 197
Hpy188I TCNGA 3 cut(s) 65, 82, 125
Hpy99I CGWCG 1 cut(s) 47
HpyCH4III ACNGT 3 cut(s) 43, 143, 225
HpyCH4V TGCA 1 cut(s) 58
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 2 cut(s) 77, 112
LpnPI CCDG 6 cut(s) 37, 102, 146, 173, 194, 221
MaeI CTAG 1 cut(s) 247
MalI GATC 2 cut(s) 79, 114
MboI GATC 2 cut(s) 77, 112
MboII GAAGA 2 cut(s) 87, 92
MflI RGATCY 1 cut(s) 77
MluCI AATT 1 cut(s) 107
MnlI CCTC 4 cut(s) 128, 131, 164, 213
MspR9I CCNGG 2 cut(s) 161, 209
MvaI CCWGG 2 cut(s) 161, 209
NdeII GATC 2 cut(s) 77, 112
PceI AGGCCT 1 cut(s) 88
PfeI GAWTC 1 cut(s) 35
PpuMI RGGWCCY 1 cut(s) 200
Psp5II RGGWCCY 1 cut(s) 200
Psp6I CCWGG 2 cut(s) 159, 207
PspGI CCWGG 2 cut(s) 159, 207
PspPI GGNCC 1 cut(s) 200
PspPPI RGGWCCY 1 cut(s) 200
PsuI RGATCY 1 cut(s) 77
RsaI GTAC 2 cut(s) 21, 131
RsaNI GTAC 2 cut(s) 20, 130
Sau3AI GATC 2 cut(s) 77, 112
Sau96I GGNCC 1 cut(s) 200
ScrFI CCNGG 2 cut(s) 161, 209
SetI ASST 6 cut(s) 12, 120, 156, 202, 210, 239
SgeI CNNG 9 cut(s) 35, 64, 84, 101, 172, 173, 220, 221, 226
SinI GGWCC 1 cut(s) 200
Sse9I AATT 1 cut(s) 107
SseBI AGGCCT 1 cut(s) 88
SspMI CTAG 1 cut(s) 247
StuI AGGCCT 1 cut(s) 88
StyD4I CCNGG 2 cut(s) 159, 207
StyI CCWWGG 1 cut(s) 213
TaaI ACNGT 3 cut(s) 43, 143, 225
TaqI TCGA 3 cut(s) 24, 73, 148
TasI AATT 1 cut(s) 107
TatI WGTACW 2 cut(s) 19, 129
TfiI GAWTC 1 cut(s) 35
TspDTI ATGAA 1 cut(s) 86
VpaK11BI GGWCC 1 cut(s) 200
XagI CCTNNNNNAGG 1 cut(s) 158
XapI RAATTY 1 cut(s) 107
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.