Rh5CG272600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
29384898 .. 29388596
3699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG272600.1

Sequence Viewer

Length: 291 bp
ATGGAGACTAGTATTAAGTGTAGTGAAGAACTGAAGCGAGCTGATGCAATGATGCTAATGTATGCCTATGATCAGCCATTGACGCTTACTCGTATCTCTAGCTTCTGGCTCCCTGAGCTTCGTCTGTTGGAGGCAATGGGGAGTGCTGCAACATCTCTTTCAAAGCTAGCAGATACAGGTCGTCAAGAATGCCCTAGTAATATGGCTGCCATTAGGCTCTTAGGAATGGAAATAAGTGATCCCACACTGGAACTGAATGATCTAAGATATACTACATCAGGTTTTACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.71

Weight (kDa)

4.68

Isoelectric Point (pI)

46.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 233
AcuI CTGAAG 1 cut(s) 53
AgsI TTSAA 1 cut(s) 162
AhlI ACTAGT 1 cut(s) 8
AluBI AGCT 4 cut(s) 41, 102, 118, 166
AluI AGCT 4 cut(s) 41, 102, 118, 166
AlwI GGATC 1 cut(s) 233
ApeKI GCWGC 2 cut(s) 146, 206
AsuNHI GCTAGC 1 cut(s) 166
BbvI GCAGC 2 cut(s) 133, 193
BclI TGATCA 1 cut(s) 70
BcuI ACTAGT 1 cut(s) 8
BfaI CTAG 4 cut(s) 9, 99, 167, 195
BisI GCNGC 2 cut(s) 147, 207
BlsI GCNGC 2 cut(s) 148, 208
BmiI GGNNCC 1 cut(s) 110
BmsI GCATC 2 cut(s) 34, 42
BmtI GCTAGC 1 cut(s) 170
Bpu10I CCTNAGC 1 cut(s) 114
Bse1I ACTGG 1 cut(s) 252
Bse3DI GCAATG 2 cut(s) 54, 141
BseMI GCAATG 2 cut(s) 54, 141
BseMII CTCAG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 252
BseXI GCAGC 2 cut(s) 133, 193
BsmI GAATGC 1 cut(s) 194
Bsp143I GATC 3 cut(s) 70, 238, 259
BspCNI CTCAG 1 cut(s) 106
BspLI GGNNCC 1 cut(s) 110
BspOI GCTAGC 1 cut(s) 170
BspPI GGATC 1 cut(s) 233
BsrDI GCAATG 2 cut(s) 54, 141
BsrI ACTGG 1 cut(s) 252
BssMI GATC 3 cut(s) 70, 238, 259
BstC8I GCNNGC 2 cut(s) 39, 168
BstDEI CTNAG 3 cut(s) 114, 220, 263
BstKTI GATC 3 cut(s) 73, 241, 262
BstMBI GATC 3 cut(s) 70, 238, 259
BstMWI GCNNNNNNNGC 2 cut(s) 82, 115
BstV1I GCAGC 2 cut(s) 133, 193
BtsIMutI CAGTG 1 cut(s) 245
Cac8I GCNNGC 2 cut(s) 39, 168
CseI GACGC 1 cut(s) 91
CviAII CATG 1 cut(s) 288
CviJI RGCY 8 cut(s) 41, 76, 102, 109, 118, 166, 206, 217
CviKI_1 RGCY 8 cut(s) 41, 76, 102, 109, 118, 166, 206, 217
DdeI CTNAG 3 cut(s) 114, 220, 263
DpnI GATC 3 cut(s) 72, 240, 261
DpnII GATC 3 cut(s) 70, 238, 259
Eco57I CTGAAG 1 cut(s) 53
FaeI CATG 1 cut(s) 291
FaiI YATR 5 cut(s) 63, 69, 203, 270, 289
FatI CATG 1 cut(s) 287
FbaI TGATCA 1 cut(s) 70
Fnu4HI GCNGC 2 cut(s) 147, 207
Fsp4HI GCNGC 2 cut(s) 147, 207
FspBI CTAG 4 cut(s) 9, 99, 167, 195
GluI GCNGC 2 cut(s) 147, 207
HgaI GACGC 1 cut(s) 91
Hin1II CATG 1 cut(s) 291
Hpy188III TCNNGA 1 cut(s) 185
HpyCH4V TGCA 2 cut(s) 47, 149
HpyF10VI GCNNNNNNNGC 2 cut(s) 82, 115
HpyF3I CTNAG 3 cut(s) 114, 220, 263
Hsp92II CATG 1 cut(s) 291
Ksp22I TGATCA 1 cut(s) 70
Kzo9I GATC 3 cut(s) 70, 238, 259
LmnI GCTCC 1 cut(s) 114
LpnPI CCDG 5 cut(s) 91, 126, 162, 233, 264
Lsp1109I GCAGC 2 cut(s) 133, 193
LweI GCATC 2 cut(s) 34, 42
MaeI CTAG 4 cut(s) 9, 99, 167, 195
MalI GATC 3 cut(s) 72, 240, 261
MboI GATC 3 cut(s) 70, 238, 259
MboII GAAGA 1 cut(s) 38
MmeI TCCRAC 1 cut(s) 108
MnlI CCTC 1 cut(s) 124
MseI TTAA 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 194
MwoI GCNNNNNNNGC 2 cut(s) 82, 115
NdeII GATC 3 cut(s) 70, 238, 259
NheI GCTAGC 1 cut(s) 166
NlaIII CATG 1 cut(s) 291
NlaIV GGNNCC 1 cut(s) 110
PctI GAATGC 1 cut(s) 194
PkrI GCNGC 2 cut(s) 148, 208
PspN4I GGNNCC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 15
SatI GCNGC 2 cut(s) 147, 207
Sau3AI GATC 3 cut(s) 70, 238, 259
SetI ASST 6 cut(s) 43, 104, 120, 168, 181, 283
SfaNI GCATC 2 cut(s) 34, 42
SpeI ACTAGT 1 cut(s) 8
SspMI CTAG 4 cut(s) 9, 99, 167, 195
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TscAI CASTG 1 cut(s) 252
TseI GCWGC 2 cut(s) 146, 206
TspRI CASTG 1 cut(s) 252
XspI CTAG 4 cut(s) 9, 99, 167, 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.