Rh6AG195500

Belongs to the glycosyl hydrolase 17 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
35129330 .. 35129677
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG195500.1

Sequence Viewer

Length: 348 bp
ATGCAGTCTCTACAAAACATTAATCTTAATGCTAAGAACCTAGCTACTCGTATTAAGGTGTCAACAGTTGTGCCAGGAACTGTTTTGGGGGCTTCATATCCGCCTTCAAGTGGTGCATTTACAGCAGATACACGTGATGTTATGAGTGGCATTCTTGCGTTCTTGTCTAGACAAGGATCGCCTCTTTTGATCAATGCGTATCCCTATTTTGCTTATGTATCTGACCCTGTAAATGTTAGATTGGATTATGCTCAATTTACTGCAACAAGTCCTGGGGCCATAGATGGAAATTTGAACCACTTTAACTTGTTTGACTCCTTGGTTGATCCCTTTTTCTCAGCCATGTAG

Protein Analysis

115

Amino Acids

12.37

Weight (kDa)

5.47

Isoelectric Point (pI)

42.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_17 PF00332 8 - 114 6.6e-22 Glycosyl hydrolases family 17
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 101
AclWI GGATC 2 cut(s) 184, 320
AcsI RAATTY 1 cut(s) 289
AcvI CACGTG 1 cut(s) 134
AfiI CCNNNNNNNGG 1 cut(s) 110
AflIII ACRYGT 1 cut(s) 131
AgsI TTSAA 2 cut(s) 108, 295
AjnI CCWGG 2 cut(s) 73, 271
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
Alw26I GTCTC 1 cut(s) 12
AlwI GGATC 2 cut(s) 184, 320
AlwNI CAGNNNCTG 1 cut(s) 80
AoxI GGCC 1 cut(s) 276
ApoI RAATTY 1 cut(s) 289
AseI ATTAAT 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 276
BbrPI CACGTG 1 cut(s) 134
BccI CCATC 1 cut(s) 278
BciT130I CCWGG 2 cut(s) 75, 273
BciVI GTATCC 1 cut(s) 210
BclI TGATCA 1 cut(s) 189
BcoDI GTCTC 1 cut(s) 12
BfaI CTAG 2 cut(s) 41, 168
BfuI GTATCC 1 cut(s) 210
Bme1390I CCNGG 2 cut(s) 75, 273
BmgT120I GGNCC 1 cut(s) 276
BmiI GGNNCC 1 cut(s) 277
BmrFI CCNGG 2 cut(s) 75, 273
BsaAI YACGTR 1 cut(s) 134
BsaJI CCNNGG 2 cut(s) 272, 318
Bsc4I CCNNNNNNNGG 1 cut(s) 110
BseBI CCWGG 2 cut(s) 75, 273
BseDI CCNNGG 2 cut(s) 272, 318
BseLI CCNNNNNNNGG 1 cut(s) 110
BshFI GGCC 1 cut(s) 278
BslI CCNNNNNNNGG 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 12
BsmI GAATGC 1 cut(s) 150
BsnI GGCC 1 cut(s) 278
Bsp143I GATC 3 cut(s) 176, 189, 325
BspACI CCGC 1 cut(s) 101
BspANI GGCC 1 cut(s) 278
BspLI GGNNCC 1 cut(s) 277
BspPI GGATC 2 cut(s) 184, 320
BssECI CCNNGG 2 cut(s) 272, 318
BssMI GATC 3 cut(s) 176, 189, 325
BssT1I CCWWGG 1 cut(s) 318
Bst2UI CCWGG 2 cut(s) 75, 273
Bst4CI ACNGT 2 cut(s) 67, 82
BstBAI YACGTR 1 cut(s) 134
BstDEI CTNAG 2 cut(s) 33, 337
BstKTI GATC 3 cut(s) 179, 192, 328
BstMAI GTCTC 1 cut(s) 12
BstMBI GATC 3 cut(s) 176, 189, 325
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstNI CCWGG 2 cut(s) 75, 273
BstSCI CCNGG 2 cut(s) 73, 271
BsuI GTATCC 1 cut(s) 210
BsuRI GGCC 1 cut(s) 278
CaiI CAGNNNCTG 1 cut(s) 80
Cfr13I GGNCC 1 cut(s) 276
CviAII CATG 1 cut(s) 343
CviJI RGCY 4 cut(s) 44, 92, 278, 341
CviKI_1 RGCY 4 cut(s) 44, 92, 278, 341
DdeI CTNAG 2 cut(s) 33, 337
DpnI GATC 3 cut(s) 178, 191, 327
DpnII GATC 3 cut(s) 176, 189, 325
EciI GGCGGA 1 cut(s) 90
Eco130I CCWWGG 1 cut(s) 318
Eco72I CACGTG 1 cut(s) 134
EcoRII CCWGG 2 cut(s) 73, 271
EcoT14I CCWWGG 1 cut(s) 318
ErhI CCWWGG 1 cut(s) 318
FaeI CATG 1 cut(s) 346
FaiI YATR 6 cut(s) 97, 143, 216, 249, 281, 344
FatI CATG 1 cut(s) 342
FbaI TGATCA 1 cut(s) 189
FspBI CTAG 2 cut(s) 41, 168
HaeIII GGCC 1 cut(s) 278
Hin1II CATG 1 cut(s) 346
HincII GTYRAC 1 cut(s) 63
HindII GTYRAC 1 cut(s) 63
HinfI GANTC 1 cut(s) 314
Hpy166II GTNNAC 1 cut(s) 63
Hpy188I TCNGA 1 cut(s) 223
Hpy188III TCNNGA 1 cut(s) 168
Hpy8I GTNNAC 1 cut(s) 63
HpyAV CCTTC 1 cut(s) 114
HpyCH4III ACNGT 2 cut(s) 67, 82
HpyCH4IV ACGT 1 cut(s) 133
HpyCH4V TGCA 3 cut(s) 4, 116, 263
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpyF3I CTNAG 2 cut(s) 33, 337
HpySE526I ACGT 1 cut(s) 133
Hsp92II CATG 1 cut(s) 346
Ksp22I TGATCA 1 cut(s) 189
Kzo9I GATC 3 cut(s) 176, 189, 325
LpnPI CCDG 5 cut(s) 60, 87, 240, 258, 285
MaeI CTAG 2 cut(s) 41, 168
MaeII ACGT 1 cut(s) 133
MalI GATC 3 cut(s) 178, 191, 327
MboI GATC 3 cut(s) 176, 189, 325
MluCI AATT 2 cut(s) 254, 289
MlyI GAGTC 1 cut(s) 308
MnlI CCTC 1 cut(s) 192
MseI TTAA 4 cut(s) 21, 27, 54, 303
MspR9I CCNGG 2 cut(s) 75, 273
Mva1269I GAATGC 1 cut(s) 150
MvaI CCWGG 2 cut(s) 75, 273
MwoI GCNNNNNNNGC 1 cut(s) 122
NdeII GATC 3 cut(s) 176, 189, 325
NlaIII CATG 1 cut(s) 346
NlaIV GGNNCC 1 cut(s) 277
PctI GAATGC 1 cut(s) 150
PleI GAGTC 1 cut(s) 308
PmaCI CACGTG 1 cut(s) 134
PmlI CACGTG 1 cut(s) 134
PpsI GAGTC 1 cut(s) 308
Ppu21I YACGTR 1 cut(s) 134
PshBI ATTAAT 1 cut(s) 21
Psp6I CCWGG 2 cut(s) 73, 271
PspCI CACGTG 1 cut(s) 134
PspGI CCWGG 2 cut(s) 73, 271
PspN4I GGNNCC 1 cut(s) 277
PspPI GGNCC 1 cut(s) 276
PstNI CAGNNNCTG 1 cut(s) 80
SaqAI TTAA 4 cut(s) 21, 27, 54, 303
Sau3AI GATC 3 cut(s) 176, 189, 325
Sau96I GGNCC 1 cut(s) 276
SchI GAGTC 1 cut(s) 308
ScrFI CCNGG 2 cut(s) 75, 273
SetI ASST 4 cut(s) 42, 46, 60, 136
Sse9I AATT 2 cut(s) 254, 289
SsiI CCGC 1 cut(s) 101
SspMI CTAG 2 cut(s) 41, 168
StyD4I CCNGG 2 cut(s) 73, 271
StyI CCWWGG 1 cut(s) 318
TaaI ACNGT 2 cut(s) 67, 82
TaiI ACGT 1 cut(s) 136
TasI AATT 2 cut(s) 254, 289
Tru1I TTAA 4 cut(s) 21, 27, 54, 303
Tru9I TTAA 4 cut(s) 21, 27, 54, 303
TspDTI ATGAA 1 cut(s) 84
VspI ATTAAT 1 cut(s) 21
XapI RAATTY 1 cut(s) 289
XbaI TCTAGA 1 cut(s) 167
XspI CTAG 2 cut(s) 41, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.