MD00G1027200.v1.1

Tudor domain-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
4526052 .. 4539413
13362 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1027200.v1.1.491

Sequence Viewer

Length: 171 bp
ATGGTTCTTCGCGACCACGAACAAGTGGAGGCGATTATCCTGATCCACTCCGCCTTGTCCGACGAGAAGCATACGGTGGTGAATCCAGTAGAAGCCGAGCTCACCAACATGGACCTCAATTCCATCTCCGCCAGGTTCTTGCCCAATGCTGAGCTTGTGTTATACGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.3

Weight (kDa)

4.62

Isoelectric Point (pI)

23.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 12
AciI CCGC 2 cut(s) 51, 129
AclWI GGATC 1 cut(s) 37
AflIII ACRYGT 1 cut(s) 165
AjnI CCWGG 1 cut(s) 131
AluBI AGCT 2 cut(s) 100, 154
AluI AGCT 2 cut(s) 100, 154
Alw21I GWGCWC 1 cut(s) 102
AlwI GGATC 1 cut(s) 37
AspS9I GGNCC 1 cut(s) 112
AsuHPI GGTGA 2 cut(s) 91, 94
AvaII GGWCC 1 cut(s) 112
BanII GRGCYC 1 cut(s) 102
Bbv12I GWGCWC 1 cut(s) 102
BccI CCATC 1 cut(s) 131
BciT130I CCWGG 1 cut(s) 133
BlpI GCTNAGC 1 cut(s) 150
Bme1390I CCNGG 1 cut(s) 133
Bme18I GGWCC 1 cut(s) 112
BmgT120I GGNCC 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 133
Bpu1102I GCTNAGC 1 cut(s) 150
BsaAI YACGTR 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 86
BseBI CCWGG 1 cut(s) 133
BseMII CTCAG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 86
Bsh1236I CGCG 1 cut(s) 12
BsiHKAI GWGCWC 1 cut(s) 102
Bsp1286I GDGCHC 1 cut(s) 102
Bsp143I GATC 1 cut(s) 42
Bsp1720I GCTNAGC 1 cut(s) 150
Bsp68I TCGCGA 1 cut(s) 12
BspACI CCGC 2 cut(s) 51, 129
BspCNI CTCAG 1 cut(s) 142
BspFNI CGCG 1 cut(s) 12
BspPI GGATC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 86
BssMI GATC 1 cut(s) 42
Bst2UI CCWGG 1 cut(s) 133
Bst4CI ACNGT 1 cut(s) 76
BstBAI YACGTR 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 150
BstFNI CGCG 1 cut(s) 12
BstKTI GATC 1 cut(s) 45
BstMBI GATC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 133
BstSCI CCNGG 1 cut(s) 131
BstUI CGCG 1 cut(s) 12
BtuMI TCGCGA 1 cut(s) 12
Cfr13I GGNCC 1 cut(s) 112
CviAII CATG 1 cut(s) 109
CviJI RGCY 3 cut(s) 95, 100, 154
CviKI_1 RGCY 3 cut(s) 95, 100, 154
DdeI CTNAG 1 cut(s) 150
DpnI GATC 1 cut(s) 44
DpnII GATC 1 cut(s) 42
EciI GGCGGA 2 cut(s) 40, 118
Ecl136II GAGCTC 1 cut(s) 100
Eco24I GRGCYC 1 cut(s) 102
Eco47I GGWCC 1 cut(s) 112
Eco53kI GAGCTC 1 cut(s) 100
EcoICRI GAGCTC 1 cut(s) 100
EcoRII CCWGG 1 cut(s) 131
EcoT38I GRGCYC 1 cut(s) 102
FaeI CATG 1 cut(s) 112
FaiI YATR 3 cut(s) 72, 110, 163
FatI CATG 1 cut(s) 108
FriOI GRGCYC 1 cut(s) 102
Hin1II CATG 1 cut(s) 112
HinfI GANTC 1 cut(s) 82
HphI GGTGA 2 cut(s) 91, 94
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 11, 40
Hpy99I CGWCG 1 cut(s) 65
HpyCH4III ACNGT 1 cut(s) 76
HpyCH4IV ACGT 1 cut(s) 165
HpyF3I CTNAG 1 cut(s) 150
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 1 cut(s) 112
Kzo9I GATC 1 cut(s) 42
LpnPI CCDG 4 cut(s) 53, 99, 118, 145
MaeII ACGT 1 cut(s) 165
MalI GATC 1 cut(s) 44
MboI GATC 1 cut(s) 42
MhlI GDGCHC 1 cut(s) 102
MluCI AATT 1 cut(s) 118
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 2 cut(s) 22, 125
MslI CAYNNNNRTG 1 cut(s) 107
MspR9I CCNGG 1 cut(s) 133
MvaI CCWGG 1 cut(s) 133
MvnI CGCG 1 cut(s) 12
NdeII GATC 1 cut(s) 42
NlaIII CATG 1 cut(s) 112
NmeAIII GCCGAG 1 cut(s) 121
NruI TCGCGA 1 cut(s) 12
PfeI GAWTC 1 cut(s) 82
Ppu21I YACGTR 1 cut(s) 166
Psp124BI GAGCTC 1 cut(s) 102
Psp6I CCWGG 1 cut(s) 131
PspGI CCWGG 1 cut(s) 131
PspPI GGNCC 1 cut(s) 112
RruI TCGCGA 1 cut(s) 12
RseI CAYNNNNRTG 1 cut(s) 107
SacI GAGCTC 1 cut(s) 102
Sau3AI GATC 1 cut(s) 42
Sau96I GGNCC 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 133
SduI GDGCHC 1 cut(s) 102
SetI ASST 5 cut(s) 102, 117, 137, 156, 168
SinI GGWCC 1 cut(s) 112
SmiMI CAYNNNNRTG 1 cut(s) 107
Sse9I AATT 1 cut(s) 118
SsiI CCGC 2 cut(s) 51, 129
SstI GAGCTC 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 131
TaaI ACNGT 1 cut(s) 76
TaiI ACGT 1 cut(s) 168
TasI AATT 1 cut(s) 118
TfiI GAWTC 1 cut(s) 82
VpaK11BI GGWCC 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.