MD02G1040400.v1.1

Tudor domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
OG0001467
Physical Location & Seq
Forward (+)
3289177 .. 3290060
884 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1040400.v1.1.491

Sequence Viewer

Length: 336 bp
ATGGTGCTTCGCGACCACGAACAAGTGGAGGCGATGATCCTGCTCCACTCCGCCTTGTCCGACGACAAGCGTACGGTGGTGAATTCAGTGGAAGCCGAGCTCACCAACATGGTCCTCAAATCTATCTCCGCTAGGTCCTTGCCCGACCCGCATACGCTCCAAATGTCCTCTCACCTCCTCGGCTCCAAGGTCCTCCAGGTAAATCACACCTCTCTGTATTTCTCGTTAATTTATCTCGTTTTCTGTTTGGTTGCTGAGAAAATAGATGAAGAGAAAGAACAATGTGGGCTCACAGAAGCGTCGTTCCTGGAACTAAGGCATAACTCATGGGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RMI1_N

Protein Analysis

112

Amino Acids

12.54

Weight (kDa)

5.39

Isoelectric Point (pI)

39.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 12
AciI CCGC 3 cut(s) 51, 129, 149
AclWI GGATC 1 cut(s) 31
AcsI RAATTY 1 cut(s) 82
AfaI GTAC 1 cut(s) 73
AjnI CCWGG 2 cut(s) 195, 306
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
Alw21I GWGCWC 1 cut(s) 102
AlwI GGATC 1 cut(s) 31
ApoI RAATTY 1 cut(s) 82
AspS9I GGNCC 3 cut(s) 112, 135, 190
AsuHPI GGTGA 3 cut(s) 91, 94, 164
AvaII GGWCC 3 cut(s) 112, 135, 190
BanII GRGCYC 2 cut(s) 102, 291
Bbv12I GWGCWC 1 cut(s) 102
BcgI CGANNNNNNTGC 2 cut(s) 22, 56
BciT130I CCWGG 2 cut(s) 197, 308
BfaI CTAG 1 cut(s) 132
Bme1390I CCNGG 2 cut(s) 197, 308
Bme18I GGWCC 3 cut(s) 112, 135, 190
BmgT120I GGNCC 3 cut(s) 112, 135, 190
BmiI GGNNCC 1 cut(s) 184
BmrFI CCNGG 2 cut(s) 197, 308
BpmI CTGGAG 1 cut(s) 179
BsaJI CCNNGG 2 cut(s) 178, 186
BseBI CCWGG 2 cut(s) 197, 308
BseDI CCNNGG 2 cut(s) 178, 186
BseMII CTCAG 1 cut(s) 246
BseRI GAGGAG 1 cut(s) 167
Bsh1236I CGCG 1 cut(s) 12
BsiHKAI GWGCWC 1 cut(s) 102
BsiWI CGTACG 1 cut(s) 71
Bsp1286I GDGCHC 2 cut(s) 102, 291
Bsp143I GATC 1 cut(s) 36
Bsp68I TCGCGA 1 cut(s) 12
BspACI CCGC 3 cut(s) 51, 129, 149
BspCNI CTCAG 1 cut(s) 247
BspFNI CGCG 1 cut(s) 12
BspLI GGNNCC 1 cut(s) 184
BspPI GGATC 1 cut(s) 31
BssECI CCNNGG 2 cut(s) 178, 186
BssMI GATC 1 cut(s) 36
BssT1I CCWWGG 1 cut(s) 186
Bst2UI CCWGG 2 cut(s) 197, 308
Bst4CI ACNGT 1 cut(s) 76
Bst6I CTCTTC 1 cut(s) 264
BstDEI CTNAG 2 cut(s) 255, 314
BstFNI CGCG 1 cut(s) 12
BstKTI GATC 1 cut(s) 39
BstMBI GATC 1 cut(s) 36
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstNI CCWGG 2 cut(s) 197, 308
BstSCI CCNGG 2 cut(s) 195, 306
BstUI CGCG 1 cut(s) 12
BtgZI GCGATG 1 cut(s) 47
BtsIMutI CAGTG 1 cut(s) 93
BtuMI TCGCGA 1 cut(s) 12
Cfr13I GGNCC 3 cut(s) 112, 135, 190
CseI GACGC 1 cut(s) 288
Csp6I GTAC 1 cut(s) 72
CviAII CATG 2 cut(s) 109, 327
CviJI RGCY 4 cut(s) 95, 100, 183, 289
CviKI_1 RGCY 4 cut(s) 95, 100, 183, 289
CviQI GTAC 1 cut(s) 72
DdeI CTNAG 2 cut(s) 255, 314
DpnI GATC 1 cut(s) 38
DpnII GATC 1 cut(s) 36
Eam1104I CTCTTC 1 cut(s) 264
EarI CTCTTC 1 cut(s) 264
EciI GGCGGA 1 cut(s) 40
Ecl136II GAGCTC 1 cut(s) 100
Eco130I CCWWGG 1 cut(s) 186
Eco24I GRGCYC 2 cut(s) 102, 291
Eco47I GGWCC 3 cut(s) 112, 135, 190
Eco53kI GAGCTC 1 cut(s) 100
EcoICRI GAGCTC 1 cut(s) 100
EcoO109I RGGNCCY 2 cut(s) 135, 190
EcoRI GAATTC 1 cut(s) 82
EcoRII CCWGG 2 cut(s) 195, 306
EcoT14I CCWWGG 1 cut(s) 186
EcoT38I GRGCYC 2 cut(s) 102, 291
ErhI CCWWGG 1 cut(s) 186
FaeI CATG 2 cut(s) 112, 330
FaiI YATR 4 cut(s) 110, 153, 321, 328
FatI CATG 2 cut(s) 108, 326
FauI CCCGC 1 cut(s) 156
FriOI GRGCYC 2 cut(s) 102, 291
FspBI CTAG 1 cut(s) 132
GsuI CTGGAG 1 cut(s) 179
HgaI GACGC 1 cut(s) 288
Hin1II CATG 2 cut(s) 112, 330
HphI GGTGA 3 cut(s) 91, 94, 164
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 1 cut(s) 11
Hpy99I CGWCG 2 cut(s) 65, 304
HpyCH4III ACNGT 1 cut(s) 76
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
HpyF3I CTNAG 2 cut(s) 255, 314
Hsp92II CATG 2 cut(s) 112, 330
Kzo9I GATC 1 cut(s) 36
LmnI GCTCC 3 cut(s) 48, 162, 188
LpnPI CCDG 5 cut(s) 53, 182, 209, 293, 320
MaeI CTAG 1 cut(s) 132
MalI GATC 1 cut(s) 38
MboI GATC 1 cut(s) 36
MboII GAAGA 1 cut(s) 281
MhlI GDGCHC 2 cut(s) 102, 291
MluCI AATT 2 cut(s) 82, 228
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 7 cut(s) 22, 125, 178, 185, 188, 203, 220
MseI TTAA 1 cut(s) 227
MslI CAYNNNNRTG 2 cut(s) 107, 331
MspR9I CCNGG 2 cut(s) 197, 308
MvaI CCWGG 2 cut(s) 197, 308
MvnI CGCG 1 cut(s) 12
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 1 cut(s) 36
NlaIII CATG 2 cut(s) 112, 330
NlaIV GGNNCC 1 cut(s) 184
NmeAIII GCCGAG 2 cut(s) 121, 159
NruI TCGCGA 1 cut(s) 12
Pfl23II CGTACG 1 cut(s) 71
PfoI TCCNGGA 1 cut(s) 306
PpuMI RGGWCCY 2 cut(s) 135, 190
Psp124BI GAGCTC 1 cut(s) 102
Psp5II RGGWCCY 2 cut(s) 135, 190
Psp6I CCWGG 2 cut(s) 195, 306
PspGI CCWGG 2 cut(s) 195, 306
PspLI CGTACG 1 cut(s) 71
PspN4I GGNNCC 1 cut(s) 184
PspPI GGNCC 3 cut(s) 112, 135, 190
PspPPI RGGWCCY 2 cut(s) 135, 190
RruI TCGCGA 1 cut(s) 12
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
RseI CAYNNNNRTG 2 cut(s) 107, 331
SacI GAGCTC 1 cut(s) 102
SaqAI TTAA 1 cut(s) 227
Sau3AI GATC 1 cut(s) 36
Sau96I GGNCC 3 cut(s) 112, 135, 190
ScrFI CCNGG 2 cut(s) 197, 308
SduI GDGCHC 2 cut(s) 102, 291
SetI ASST 6 cut(s) 102, 137, 177, 192, 201, 212
SinI GGWCC 3 cut(s) 112, 135, 190
SmiMI CAYNNNNRTG 2 cut(s) 107, 331
Sse9I AATT 2 cut(s) 82, 228
SsiI CCGC 3 cut(s) 51, 129, 149
SspMI CTAG 1 cut(s) 132
SstI GAGCTC 1 cut(s) 102
StyD4I CCNGG 2 cut(s) 195, 306
StyI CCWWGG 1 cut(s) 186
TaaI ACNGT 1 cut(s) 76
TasI AATT 2 cut(s) 82, 228
Tru1I TTAA 1 cut(s) 227
Tru9I TTAA 1 cut(s) 227
TscAI CASTG 1 cut(s) 93
TspDTI ATGAA 1 cut(s) 282
TspRI CASTG 1 cut(s) 93
VpaK11BI GGWCC 3 cut(s) 112, 135, 190
XapI RAATTY 1 cut(s) 82
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.