Rroxscaffold_2G00127190

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001467
Physical Location & Seq
Reverse (-)
62647186 .. 62650989
3804 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00127190.1

Sequence Viewer

Length: 285 bp
ATGCAGATGAGGGTTCTGGTGATTTCTGGAGGTTTGAAGGCTGGTTTCATGGAATTTGGCATAGGCCTTGCTCGACCCATTGTCCTGAAATGCTCCTGTTGCTATTTGCTTCACGTTGGGTTCGATTTTGGGGGGTTTTCCATTATGCTGAAAAGGGGATTGAGTTGGGTTCGAGTTGAAGAAGGAGGAAAGGGGTTTCACGGGTTTAGGGATTGTTGCTCAGTTCCTTTCGACTGCATCAAGAGCAACCTCGTTGGCTCTCACCTAGTCGAATCTGCTCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.26

Weight (kDa)

8.63

Isoelectric Point (pI)

19.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 53
AgsI TTSAA 2 cut(s) 37, 179
AhdI GACNNNNNGTC 1 cut(s) 80
AoxI GGCC 1 cut(s) 64
ApoI RAATTY 1 cut(s) 53
AsuHPI GGTGA 2 cut(s) 31, 254
BfaI CTAG 1 cut(s) 266
BmeRI GACNNNNNGTC 1 cut(s) 80
BmsI GCATC 1 cut(s) 246
BpmI CTGGAG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 234
BshFI GGCC 1 cut(s) 66
BsnI GGCC 1 cut(s) 66
BspANI GGCC 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 233
BstDEI CTNAG 1 cut(s) 220
BstMWI GCNNNNNNNGC 2 cut(s) 99, 243
BsuRI GGCC 1 cut(s) 66
CviAII CATG 1 cut(s) 49
CviJI RGCY 3 cut(s) 41, 66, 258
CviKI_1 RGCY 3 cut(s) 41, 66, 258
DdeI CTNAG 1 cut(s) 220
DriI GACNNNNNGTC 1 cut(s) 80
Eam1105I GACNNNNNGTC 1 cut(s) 80
Eco147I AGGCCT 1 cut(s) 66
FaeI CATG 1 cut(s) 52
FaiI YATR 3 cut(s) 50, 62, 146
FatI CATG 1 cut(s) 48
FspBI CTAG 1 cut(s) 266
GsuI CTGGAG 1 cut(s) 48
HaeIII GGCC 1 cut(s) 66
Hin1II CATG 1 cut(s) 52
HinfI GANTC 1 cut(s) 272
HphI GGTGA 2 cut(s) 31, 254
Hpy188III TCNNGA 3 cut(s) 27, 85, 241
HpyAV CCTTC 2 cut(s) 31, 176
HpyCH4IV ACGT 1 cut(s) 114
HpyCH4V TGCA 2 cut(s) 4, 237
HpyF10VI GCNNNNNNNGC 2 cut(s) 99, 243
HpyF3I CTNAG 1 cut(s) 220
HpySE526I ACGT 1 cut(s) 114
Hsp92II CATG 1 cut(s) 52
LmnI GCTCC 1 cut(s) 98
LpnPI CCDG 5 cut(s) 2, 12, 27, 98, 109
LweI GCATC 1 cut(s) 246
MaeI CTAG 1 cut(s) 266
MaeII ACGT 1 cut(s) 114
MboII GAAGA 1 cut(s) 191
MluCI AATT 1 cut(s) 53
MnlI CCTC 4 cut(s) 3, 23, 179, 260
MwoI GCNNNNNNNGC 2 cut(s) 99, 243
NlaIII CATG 1 cut(s) 52
PceI AGGCCT 1 cut(s) 66
PcsI WCGNNNNNNNCGW 1 cut(s) 120
PfeI GAWTC 1 cut(s) 272
SetI ASST 4 cut(s) 34, 117, 252, 267
SfaNI GCATC 1 cut(s) 246
Sse9I AATT 1 cut(s) 53
SseBI AGGCCT 1 cut(s) 66
SspMI CTAG 1 cut(s) 266
StuI AGGCCT 1 cut(s) 66
TaiI ACGT 1 cut(s) 117
TaqI TCGA 5 cut(s) 73, 123, 172, 231, 270
TasI AATT 1 cut(s) 53
TfiI GAWTC 1 cut(s) 272
TspDTI ATGAA 1 cut(s) 37
XapI RAATTY 1 cut(s) 53
XspI CTAG 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.