Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr02

Orthogroup ID

OG0001467

Physical Location & Seq

Genomic Coordinates Forward (+)

3364506 .. 3365334

Gene Structure 829 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD02G1041100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 369 bp

ATGGTGCTTCGCGACCACGAACAAGTGGAGGCGATGATCCTGCTCCACTCAGCCTTGTCCGACGACAAGCGTACGGTGGTGAATTCAGTGGAAGCCGAGCTCACCAACATGGACCTCAAATCTATCTCCGCTAGGTCCTTGCCCGACCCGCTTACGCTCCAAAAGTCCTCTCACCTCCTCGGCTCCAAGGTCCTCCAGAGTAGTAGGCGGCTTTTGAAACTTGGGCTCGTTCCTGGAACCAAGGTACTTACTGCTTGTGTTATACAAGTACATTTTTTAATTTTGACATTTATTAAGAGGAACACCATTATGCACTGGATACAAGTACATTTTCATGAAACTCAATATGAATTTCATAAGAATTTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RMI1_N

Protein Analysis

123

Amino Acids

13.98

Weight (kDa)

9.25

Isoelectric Point (pI)

43.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001467)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g49050
malus_domestica	MD00G1026200.v1.1 MD00G1027200.v1.1 MD00G1027300.v1.1 MD02G1040400.v1.1 MD02G1040800.v1.1 MD02G1041100.v1.1 MD02G1041500.v1.1 MD02G1041600.v1.1 MD11G1046200.v1.1 MD15G1234700.v1.1
pyrus_communis	pycom02g03190 pycom02g03430 pycom02g03440 pycom09g10760 pycom09g12970
rosa_chinensis	RchiOBHm_Chr1g0367931
rosa_laevigata	RLG00000009858 RLG00000017790 RLG00000029248 RLG00000036011
rosa_multiflora	Rmu_sc0000243.1_g000024 Rmu_sc0007790.1_g000006 Rmu_sc0012870.1_g000004
rosa_roxburghii	Rroxscaffold_1G00037580 Rroxscaffold_1G00038180 Rroxscaffold_1G00049490 Rroxscaffold_2G00089170 Rroxscaffold_2G00095040 Rroxscaffold_2G00127190 Rroxscaffold_3G00227090 Rroxscaffold_4G00301620
rosa_rugosa	Rorug02G0254800 Rorug03G0325900 Rorug05G0157000 Rorug05G0237600
rosa_samantha	Rh1BG165600 Rh1BG241700 Rh1DG196200 Rh1DG270500 Rh2BG468700 Rh2CG265400 Rh2CG401400 Rh3CG316000 Rh3DG350500 Rh4BG102900 Rh4DG196700 Rh5CG562400 Rh5DG264100 Rh7DG148300 Rh7DG240400
rosa_wichuraiana	Rw5G007280

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	12
AciI	CCGC	3 cut(s)	129, 149, 208
AclWI	GGATC	1 cut(s)	31
AcsI	RAATTY	3 cut(s)	82, 350, 361
AfaI	GTAC	4 cut(s)	73, 246, 270, 327
AgsI	TTSAA	1 cut(s)	217
AjnI	CCWGG	1 cut(s)	232
AluBI	AGCT	1 cut(s)	100
AluI	AGCT	1 cut(s)	100
Alw21I	GWGCWC	1 cut(s)	102
AlwI	GGATC	1 cut(s)	31
ApoI	RAATTY	3 cut(s)	82, 350, 361
AspS9I	GGNCC	3 cut(s)	112, 135, 190
AsuHPI	GGTGA	3 cut(s)	91, 94, 164
AvaII	GGWCC	3 cut(s)	112, 135, 190
BanII	GRGCYC	2 cut(s)	102, 228
Bbv12I	GWGCWC	1 cut(s)	102
BcgI	CGANNNNNNTGC	2 cut(s)	22, 56
BciT130I	CCWGG	1 cut(s)	234
BciVI	GTATCC	1 cut(s)	312
BfaI	CTAG	1 cut(s)	132
BfuI	GTATCC	1 cut(s)	312
BisI	GCNGC	1 cut(s)	209
BlsI	GCNGC	1 cut(s)	210
Bme1390I	CCNGG	1 cut(s)	234
Bme18I	GGWCC	3 cut(s)	112, 135, 190
BmgT120I	GGNCC	3 cut(s)	112, 135, 190
BmiI	GGNNCC	2 cut(s)	184, 238
BmrFI	CCNGG	1 cut(s)	234
BpmI	CTGGAG	1 cut(s)	179
BsaJI	CCNNGG	3 cut(s)	178, 186, 240
Bse1I	ACTGG	1 cut(s)	320
BseBI	CCWGG	1 cut(s)	234
BseDI	CCNNGG	3 cut(s)	178, 186, 240
BseMII	CTCAG	1 cut(s)	63
BseNI	ACTGG	1 cut(s)	320
BseRI	GAGGAG	1 cut(s)	167
Bsh1236I	CGCG	1 cut(s)	12
BsiHKAI	GWGCWC	1 cut(s)	102
BsiWI	CGTACG	1 cut(s)	71
Bsp1286I	GDGCHC	2 cut(s)	102, 228
Bsp143I	GATC	1 cut(s)	36
Bsp68I	TCGCGA	1 cut(s)	12
BspACI	CCGC	3 cut(s)	129, 149, 208
BspCNI	CTCAG	1 cut(s)	62
BspFNI	CGCG	1 cut(s)	12
BspHI	TCATGA	1 cut(s)	334
BspLI	GGNNCC	2 cut(s)	184, 238
BspPI	GGATC	1 cut(s)	31
BsrI	ACTGG	1 cut(s)	320
BssECI	CCNNGG	3 cut(s)	178, 186, 240
BssMI	GATC	1 cut(s)	36
BssT1I	CCWWGG	2 cut(s)	186, 240
Bst2UI	CCWGG	1 cut(s)	234
Bst4CI	ACNGT	1 cut(s)	76
BstDEI	CTNAG	1 cut(s)	49
BstFNI	CGCG	1 cut(s)	12
BstKTI	GATC	1 cut(s)	39
BstMBI	GATC	1 cut(s)	36
BstMWI	GCNNNNNNNGC	1 cut(s)	148
BstNI	CCWGG	1 cut(s)	234
BstSCI	CCNGG	1 cut(s)	232
BstUI	CGCG	1 cut(s)	12
BsuI	GTATCC	1 cut(s)	312
BtgZI	GCGATG	1 cut(s)	47
BtsIMutI	CAGTG	2 cut(s)	93, 313
BtuMI	TCGCGA	1 cut(s)	12
CciI	TCATGA	1 cut(s)	334
Cfr13I	GGNCC	3 cut(s)	112, 135, 190
Csp6I	GTAC	4 cut(s)	72, 245, 269, 326
CviAII	CATG	2 cut(s)	109, 335
CviJI	RGCY	6 cut(s)	53, 95, 100, 183, 211, 226
CviKI_1	RGCY	6 cut(s)	53, 95, 100, 183, 211, 226
CviQI	GTAC	4 cut(s)	72, 245, 269, 326
DdeI	CTNAG	1 cut(s)	49
DpnI	GATC	1 cut(s)	38
DpnII	GATC	1 cut(s)	36
Ecl136II	GAGCTC	1 cut(s)	100
Eco130I	CCWWGG	2 cut(s)	186, 240
Eco24I	GRGCYC	2 cut(s)	102, 228
Eco47I	GGWCC	3 cut(s)	112, 135, 190
Eco53kI	GAGCTC	1 cut(s)	100
EcoICRI	GAGCTC	1 cut(s)	100
EcoO109I	RGGNCCY	2 cut(s)	135, 190
EcoRI	GAATTC	1 cut(s)	82
EcoRII	CCWGG	1 cut(s)	232
EcoT14I	CCWWGG	2 cut(s)	186, 240
EcoT38I	GRGCYC	2 cut(s)	102, 228
ErhI	CCWWGG	2 cut(s)	186, 240
FaeI	CATG	2 cut(s)	112, 338
FaiI	YATR	6 cut(s)	110, 263, 311, 336, 348, 357
FatI	CATG	2 cut(s)	108, 334
FauI	CCCGC	1 cut(s)	156
Fnu4HI	GCNGC	1 cut(s)	209
FriOI	GRGCYC	2 cut(s)	102, 228
Fsp4HI	GCNGC	1 cut(s)	209
FspBI	CTAG	1 cut(s)	132
GluI	GCNGC	1 cut(s)	209
GsuI	CTGGAG	1 cut(s)	179
Hin1II	CATG	2 cut(s)	112, 338
HphI	GGTGA	3 cut(s)	91, 94, 164
Hpy188I	TCNGA	1 cut(s)	61
Hpy188III	TCNNGA	3 cut(s)	11, 196, 335
Hpy99I	CGWCG	1 cut(s)	65
HpyCH4III	ACNGT	1 cut(s)	76
HpyCH4V	TGCA	1 cut(s)	313
HpyF10VI	GCNNNNNNNGC	1 cut(s)	148
HpyF3I	CTNAG	1 cut(s)	49
Hsp92II	CATG	2 cut(s)	112, 338
Kzo9I	GATC	1 cut(s)	36
LmnI	GCTCC	3 cut(s)	48, 162, 188
LpnPI	CCDG	5 cut(s)	53, 209, 219, 246, 301
MaeI	CTAG	1 cut(s)	132
MalI	GATC	1 cut(s)	38
MboI	GATC	1 cut(s)	36
MhlI	GDGCHC	2 cut(s)	102, 228
MluCI	AATT	4 cut(s)	82, 279, 350, 361
MmeI	TCCRAC	1 cut(s)	84
MnlI	CCTC	7 cut(s)	22, 125, 178, 185, 188, 203, 291
MseI	TTAA	2 cut(s)	278, 294
MslI	CAYNNNNRTG	3 cut(s)	107, 308, 333
MspR9I	CCNGG	1 cut(s)	234
MvaI	CCWGG	1 cut(s)	234
MvnI	CGCG	1 cut(s)	12
MwoI	GCNNNNNNNGC	1 cut(s)	148
NdeII	GATC	1 cut(s)	36
NlaIII	CATG	2 cut(s)	112, 338
NlaIV	GGNNCC	2 cut(s)	184, 238
NmeAIII	GCCGAG	2 cut(s)	121, 159
NruI	TCGCGA	1 cut(s)	12
PagI	TCATGA	1 cut(s)	334
Pfl23II	CGTACG	1 cut(s)	71
PfoI	TCCNGGA	1 cut(s)	232
PkrI	GCNGC	1 cut(s)	210
PpuMI	RGGWCCY	2 cut(s)	135, 190
Psp124BI	GAGCTC	1 cut(s)	102
Psp5II	RGGWCCY	2 cut(s)	135, 190
Psp6I	CCWGG	1 cut(s)	232
PspGI	CCWGG	1 cut(s)	232
PspLI	CGTACG	1 cut(s)	71
PspN4I	GGNNCC	2 cut(s)	184, 238
PspPI	GGNCC	3 cut(s)	112, 135, 190
PspPPI	RGGWCCY	2 cut(s)	135, 190
RruI	TCGCGA	1 cut(s)	12
RsaI	GTAC	4 cut(s)	73, 246, 270, 327
RsaNI	GTAC	4 cut(s)	72, 245, 269, 326
RseI	CAYNNNNRTG	3 cut(s)	107, 308, 333
SacI	GAGCTC	1 cut(s)	102
SaqAI	TTAA	2 cut(s)	278, 294
SatI	GCNGC	1 cut(s)	209
Sau3AI	GATC	1 cut(s)	36
Sau96I	GGNCC	3 cut(s)	112, 135, 190
ScrFI	CCNGG	1 cut(s)	234
SduI	GDGCHC	2 cut(s)	102, 228
SetI	ASST	6 cut(s)	102, 117, 137, 177, 192, 246
SinI	GGWCC	3 cut(s)	112, 135, 190
SmiMI	CAYNNNNRTG	3 cut(s)	107, 308, 333
Sse9I	AATT	4 cut(s)	82, 279, 350, 361
SsiI	CCGC	3 cut(s)	129, 149, 208
SspMI	CTAG	1 cut(s)	132
SstI	GAGCTC	1 cut(s)	102
StyD4I	CCNGG	1 cut(s)	232
StyI	CCWWGG	2 cut(s)	186, 240
TaaI	ACNGT	1 cut(s)	76
TasI	AATT	4 cut(s)	82, 279, 350, 361
TatI	WGTACW	2 cut(s)	268, 325
TauI	GCSGC	1 cut(s)	211
Tru1I	TTAA	2 cut(s)	278, 294
Tru9I	TTAA	2 cut(s)	278, 294
TscAI	CASTG	2 cut(s)	93, 320
TspDTI	ATGAA	4 cut(s)	323, 344, 351, 363
TspRI	CASTG	2 cut(s)	93, 320
VpaK11BI	GGWCC	3 cut(s)	112, 135, 190
XapI	RAATTY	3 cut(s)	82, 350, 361
XspI	CTAG	1 cut(s)	132

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.