MD11G1046200.v1.1

Tudor domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0001467
Physical Location & Seq
Reverse (-)
4016286 .. 4016613
328 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1046200.v1.1.491

Sequence Viewer

Length: 249 bp
ATGGTGCTTCGCGACCACGAACAAGTGGAGGCGATTATCCTGATCCACTCCGCCTTGTCCGACGACAAGCGTAAGGTGGTGAATTCAGTGGAAGCCGAGCTCACCAACATGGACCTAAAATCCATCTCCGCCAGGTCCTTGCCCGACCCGCATACGCTCCGAAAGTCCTCTCACCTCCTCGGCTCCAAAGTCCTCCAGAAAAATGTGGTCTTTCTTTTGCGAGGAATTCGAGTAGTCGGCGGCTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RMI1_N

Protein Analysis

83

Amino Acids

9.13

Weight (kDa)

9.69

Isoelectric Point (pI)

30.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 12
AciI CCGC 4 cut(s) 51, 129, 149, 240
AclWI GGATC 1 cut(s) 37
AcsI RAATTY 2 cut(s) 82, 225
AjnI CCWGG 1 cut(s) 131
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
Alw21I GWGCWC 1 cut(s) 102
AlwI GGATC 1 cut(s) 37
ApoI RAATTY 2 cut(s) 82, 225
AspS9I GGNCC 2 cut(s) 112, 135
AsuHPI GGTGA 3 cut(s) 91, 94, 164
AvaII GGWCC 2 cut(s) 112, 135
BanII GRGCYC 1 cut(s) 102
Bbv12I GWGCWC 1 cut(s) 102
BccI CCATC 1 cut(s) 131
BciT130I CCWGG 1 cut(s) 133
BisI GCNGC 1 cut(s) 241
BlsI GCNGC 1 cut(s) 242
Bme1390I CCNGG 1 cut(s) 133
Bme18I GGWCC 2 cut(s) 112, 135
BmgT120I GGNCC 2 cut(s) 112, 135
BmiI GGNNCC 1 cut(s) 184
BmrFI CCNGG 1 cut(s) 133
BpmI CTGGAG 1 cut(s) 179
BsaJI CCNNGG 1 cut(s) 178
BseBI CCWGG 1 cut(s) 133
BseDI CCNNGG 1 cut(s) 178
BseRI GAGGAG 1 cut(s) 167
Bsh1236I CGCG 1 cut(s) 12
BsiHKAI GWGCWC 1 cut(s) 102
Bsp1286I GDGCHC 1 cut(s) 102
Bsp143I GATC 1 cut(s) 42
Bsp68I TCGCGA 1 cut(s) 12
BspACI CCGC 4 cut(s) 51, 129, 149, 240
BspFNI CGCG 1 cut(s) 12
BspLI GGNNCC 1 cut(s) 184
BspPI GGATC 1 cut(s) 37
BssECI CCNNGG 1 cut(s) 178
BssMI GATC 1 cut(s) 42
Bst2UI CCWGG 1 cut(s) 133
BstFNI CGCG 1 cut(s) 12
BstKTI GATC 1 cut(s) 45
BstMBI GATC 1 cut(s) 42
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstNI CCWGG 1 cut(s) 133
BstSCI CCNGG 1 cut(s) 131
BstUI CGCG 1 cut(s) 12
BtsIMutI CAGTG 1 cut(s) 93
BtuMI TCGCGA 1 cut(s) 12
Cfr13I GGNCC 2 cut(s) 112, 135
CviAII CATG 1 cut(s) 109
CviJI RGCY 4 cut(s) 95, 100, 183, 243
CviKI_1 RGCY 4 cut(s) 95, 100, 183, 243
DpnI GATC 1 cut(s) 44
DpnII GATC 1 cut(s) 42
EciI GGCGGA 2 cut(s) 40, 118
Ecl136II GAGCTC 1 cut(s) 100
Eco24I GRGCYC 1 cut(s) 102
Eco47I GGWCC 2 cut(s) 112, 135
Eco53kI GAGCTC 1 cut(s) 100
EcoICRI GAGCTC 1 cut(s) 100
EcoO109I RGGNCCY 1 cut(s) 135
EcoRI GAATTC 2 cut(s) 82, 225
EcoRII CCWGG 1 cut(s) 131
EcoT38I GRGCYC 1 cut(s) 102
FaeI CATG 1 cut(s) 112
FaiI YATR 2 cut(s) 110, 153
FatI CATG 1 cut(s) 108
FauI CCCGC 1 cut(s) 156
Fnu4HI GCNGC 1 cut(s) 241
FriOI GRGCYC 1 cut(s) 102
Fsp4HI GCNGC 1 cut(s) 241
GluI GCNGC 1 cut(s) 241
GsuI CTGGAG 1 cut(s) 179
Hin1II CATG 1 cut(s) 112
HphI GGTGA 3 cut(s) 91, 94, 164
Hpy188I TCNGA 2 cut(s) 61, 161
Hpy188III TCNNGA 3 cut(s) 11, 40, 196
Hpy99I CGWCG 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
Hsp92II CATG 1 cut(s) 112
Kzo9I GATC 1 cut(s) 42
LmnI GCTCC 2 cut(s) 162, 188
LpnPI CCDG 4 cut(s) 53, 118, 145, 209
MalI GATC 1 cut(s) 44
MboI GATC 1 cut(s) 42
MhlI GDGCHC 1 cut(s) 102
MluCI AATT 2 cut(s) 82, 225
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 6 cut(s) 22, 178, 185, 188, 203, 215
MslI CAYNNNNRTG 1 cut(s) 107
MspR9I CCNGG 1 cut(s) 133
MvaI CCWGG 1 cut(s) 133
MvnI CGCG 1 cut(s) 12
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 1 cut(s) 42
NlaIII CATG 1 cut(s) 112
NlaIV GGNNCC 1 cut(s) 184
NmeAIII GCCGAG 2 cut(s) 121, 159
NruI TCGCGA 1 cut(s) 12
PkrI GCNGC 1 cut(s) 242
PpuMI RGGWCCY 1 cut(s) 135
Psp124BI GAGCTC 1 cut(s) 102
Psp5II RGGWCCY 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 131
PspGI CCWGG 1 cut(s) 131
PspN4I GGNNCC 1 cut(s) 184
PspPI GGNCC 2 cut(s) 112, 135
PspPPI RGGWCCY 1 cut(s) 135
RruI TCGCGA 1 cut(s) 12
RseI CAYNNNNRTG 1 cut(s) 107
SacI GAGCTC 1 cut(s) 102
SatI GCNGC 1 cut(s) 241
Sau3AI GATC 1 cut(s) 42
Sau96I GGNCC 2 cut(s) 112, 135
ScrFI CCNGG 1 cut(s) 133
SduI GDGCHC 1 cut(s) 102
SetI ASST 5 cut(s) 78, 102, 117, 137, 177
SinI GGWCC 2 cut(s) 112, 135
SmiMI CAYNNNNRTG 1 cut(s) 107
Sse9I AATT 2 cut(s) 82, 225
SsiI CCGC 4 cut(s) 51, 129, 149, 240
SstI GAGCTC 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 131
TaqI TCGA 1 cut(s) 229
TasI AATT 2 cut(s) 82, 225
TauI GCSGC 1 cut(s) 243
TscAI CASTG 1 cut(s) 93
TspRI CASTG 1 cut(s) 93
VpaK11BI GGWCC 2 cut(s) 112, 135
XapI RAATTY 2 cut(s) 82, 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.