Rh7DG148300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
12757866 .. 12759940
2075 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG148300.1

Sequence Viewer

Length: 279 bp
ATGCTTGTTCTCGCGCTGGTCAAGACATTCGATTCTGTGTTCTCTGCCTATGAAGGTTTCTGTAGCTTGAAGTTGATCTTGGTTTTCAAGGTTTCTGATCTTGGTTTATATGCTTACAACAGGCTTCCTTCTGAGTTAATGGCGTTAATGAACATCTGTGGAGAAGAATTCAAAGAATTCATATGTAGAAGGCAGGTGAGGTCATGGAATTTGAGTACCAAAAGAAGTATCAAAGATAAACTCTTTTCGTTCAGCTTGTTGCAGGATAGAAAACTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.72

Weight (kDa)

9.33

Isoelectric Point (pI)

50.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 184
Acc36I ACCTGC 1 cut(s) 184
AccII CGCG 1 cut(s) 14
AcsI RAATTY 3 cut(s) 167, 176, 208
AfaI GTAC 1 cut(s) 217
AgsI TTSAA 3 cut(s) 70, 88, 172
AjuI GAANNNNNNNTTGG 2 cut(s) 62, 94
AluBI AGCT 2 cut(s) 66, 255
AluI AGCT 2 cut(s) 66, 255
ApoI RAATTY 3 cut(s) 167, 176, 208
AspLEI GCGC 1 cut(s) 16
AsuHPI GGTGA 1 cut(s) 208
BfaI CTAG 1 cut(s) 277
BfmI CTRYAG 1 cut(s) 61
BfuAI ACCTGC 1 cut(s) 184
BseMII CTCAG 1 cut(s) 123
Bsh1236I CGCG 1 cut(s) 14
Bsp143I GATC 2 cut(s) 75, 97
BspCNI CTCAG 1 cut(s) 124
BspFNI CGCG 1 cut(s) 14
BspMI ACCTGC 1 cut(s) 184
BssMI GATC 2 cut(s) 75, 97
BstDEI CTNAG 1 cut(s) 132
BstFNI CGCG 1 cut(s) 14
BstHHI GCGC 1 cut(s) 16
BstKTI GATC 2 cut(s) 78, 100
BstMBI GATC 2 cut(s) 75, 97
BstSFI CTRYAG 1 cut(s) 61
BstUI CGCG 1 cut(s) 14
BveI ACCTGC 1 cut(s) 184
CfoI GCGC 1 cut(s) 16
Csp6I GTAC 1 cut(s) 216
CviAII CATG 1 cut(s) 204
CviJI RGCY 3 cut(s) 66, 124, 255
CviKI_1 RGCY 3 cut(s) 66, 124, 255
CviQI GTAC 1 cut(s) 216
DdeI CTNAG 1 cut(s) 132
DpnI GATC 2 cut(s) 77, 99
DpnII GATC 2 cut(s) 75, 97
EcoRI GAATTC 2 cut(s) 167, 176
FaeI CATG 1 cut(s) 207
FaiI YATR 6 cut(s) 51, 109, 111, 182, 184, 205
FalI AAGNNNNNCTT 2 cut(s) 62, 94
FatI CATG 1 cut(s) 203
FauNDI CATATG 1 cut(s) 182
FspBI CTAG 1 cut(s) 277
GlaI GCGC 1 cut(s) 15
HhaI GCGC 1 cut(s) 16
Hin1II CATG 1 cut(s) 207
Hin6I GCGC 1 cut(s) 14
HinP1I GCGC 1 cut(s) 14
HinfI GANTC 1 cut(s) 32
HphI GGTGA 1 cut(s) 208
Hpy188I TCNGA 2 cut(s) 97, 133
Hpy188III TCNNGA 1 cut(s) 22
HpyAV CCTTC 3 cut(s) 47, 138, 183
HpyCH4V TGCA 1 cut(s) 262
HpyF3I CTNAG 1 cut(s) 132
Hsp92II CATG 1 cut(s) 207
HspAI GCGC 1 cut(s) 14
Kzo9I GATC 2 cut(s) 75, 97
LpnPI CCDG 4 cut(s) 2, 106, 179, 248
MaeI CTAG 1 cut(s) 277
MalI GATC 2 cut(s) 77, 99
MboI GATC 2 cut(s) 75, 97
MboII GAAGA 1 cut(s) 176
MluCI AATT 3 cut(s) 167, 176, 208
MnlI CCTC 1 cut(s) 192
MseI TTAA 2 cut(s) 137, 146
MvnI CGCG 1 cut(s) 14
NdeI CATATG 1 cut(s) 182
NdeII GATC 2 cut(s) 75, 97
NlaIII CATG 1 cut(s) 207
PaqCI CACCTGC 1 cut(s) 184
PfeI GAWTC 1 cut(s) 32
RsaI GTAC 1 cut(s) 217
RsaNI GTAC 1 cut(s) 216
SaqAI TTAA 2 cut(s) 137, 146
Sau3AI GATC 2 cut(s) 75, 97
SetI ASST 6 cut(s) 58, 68, 93, 198, 203, 257
SfcI CTRYAG 1 cut(s) 61
Sse9I AATT 3 cut(s) 167, 176, 208
SspMI CTAG 1 cut(s) 277
TaqI TCGA 1 cut(s) 30
TasI AATT 3 cut(s) 167, 176, 208
TfiI GAWTC 1 cut(s) 32
Tru1I TTAA 2 cut(s) 137, 146
Tru9I TTAA 2 cut(s) 137, 146
TspDTI ATGAA 3 cut(s) 66, 164, 169
XapI RAATTY 3 cut(s) 167, 176, 208
XspI CTAG 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.