Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr01

Orthogroup ID

OG0001337

Physical Location & Seq

Genomic Coordinates Forward (+)

21149570 .. 21149850

Gene Structure 281 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD01G1096900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

ATGGCTAGAAATGATATAGCAGATGTTGAGTCCTTGCAACTTGACTTGGAAACTATTGAAACTACAACAAACAAGTTTTCTGAGAGTAATAAGTTAGGCCAAGGCGGATTTGGTGAAGTTTTCAAGGGAACGCTTGGTGTTAATGGACAAGAAATAGCAGTAAAGAGGTTGTCGAAAAGCTCGGTGCTGTTAGGATGCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0006952 GO:0008150 GO:0008152 GO:0009605 GO:0009607 GO:0009617 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0042742 GO:0043170 GO:0043207 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0050896 GO:0051704 GO:0051707 GO:0071704 GO:0071944 GO:0098542 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr Stress-antifung

Protein Analysis

67

Amino Acids

7.05

Weight (kDa)

4.89

Isoelectric Point (pI)

43.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001337)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g15100 FvH4_6g44105
malus_domestica	MD01G1096900.v1.1 MD02G1230400.v1.1 MD05G1226300.v1.1 MD09G1060000.v1.1 MD10G1207900.v1.1
prunus_persica	Prupe.1G289900_v2.0.a1
pyrus_communis	pycom04g03900 pycom05g20970 pycom10g17660
rosa_chinensis	RchiOBHm_Chr1g0314521 RchiOBHm_Chr1g0379221 RchiOBHm_Chr1g0379371 RchiOBHm_Chr1g0380681 RchiOBHm_Chr2g0114671 RchiOBHm_Chr4g0417601 RchiOBHm_Chr5g0025111 RchiOBHm_Chr5g0025141 RchiOBHm_Chr5g0025341 RchiOBHm_Chr5g0025391 RchiOBHm_Chr5g0025401 RchiOBHm_Chr5g0025431 RchiOBHm_Chr5g0026461 RchiOBHm_Chr5g0044581 RchiOBHm_Chr7g0196231 RchiOBHm_Chr7g0210551 RchiOBHm_Chr7g0210611
rosa_laevigata	RLG00000036334
rosa_multiflora	Rmu_co8021090.1_g000001 Rmu_co8025508.1_g000001 Rmu_co8173660.1_g000001 Rmu_sc0000936.1_g000004 Rmu_sc0005400.1_g000014 Rmu_sc0006827.1_g000017 Rmu_sc0034978.1_g000001
rosa_roxburghii	Rroxscaffold_1G00044210 Rroxscaffold_1G00053750 Rroxscaffold_1G00053800 Rroxscaffold_1G00053990 Rroxscaffold_1G00054530 Rroxscaffold_2G00089210 Rroxscaffold_2G00089260 Rroxscaffold_2G00089290 Rroxscaffold_2G00138080
rosa_rugosa	Rorug04G0436200
rosa_samantha	Rh5AG038500 Rh5AG038700 Rh5AG249800 Rh5BG471500 Rh5DG185400 Rh7AG216200 Rh7BG201000
rosa_wichuraiana	Rw5G016160

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	105
AgsI	TTSAA	2 cut(s)	59, 124
AluBI	AGCT	1 cut(s)	180
AluI	AGCT	1 cut(s)	180
AoxI	GGCC	1 cut(s)	97
AsuHPI	GGTGA	1 cut(s)	125
BfaI	CTAG	1 cut(s)	6
BmsI	GCATC	1 cut(s)	185
BsaJI	CCNNGG	1 cut(s)	100
BseDI	CCNNGG	1 cut(s)	100
BseGI	GGATG	1 cut(s)	200
BseMII	CTCAG	1 cut(s)	72
BshFI	GGCC	1 cut(s)	99
BsnI	GGCC	1 cut(s)	99
BspACI	CCGC	1 cut(s)	105
BspANI	GGCC	1 cut(s)	99
BspCNI	CTCAG	1 cut(s)	73
BssECI	CCNNGG	1 cut(s)	100
BssT1I	CCWWGG	1 cut(s)	100
BstDEI	CTNAG	1 cut(s)	81
BstF5I	GGATG	1 cut(s)	200
BsuRI	GGCC	1 cut(s)	99
BtsCI	GGATG	1 cut(s)	200
CviJI	RGCY	3 cut(s)	5, 99, 180
CviKI_1	RGCY	3 cut(s)	5, 99, 180
DdeI	CTNAG	1 cut(s)	81
EciI	GGCGGA	1 cut(s)	120
Eco130I	CCWWGG	1 cut(s)	100
EcoT14I	CCWWGG	1 cut(s)	100
ErhI	CCWWGG	1 cut(s)	100
FaiI	YATR	1 cut(s)	17
FspBI	CTAG	1 cut(s)	6
HaeIII	GGCC	1 cut(s)	99
HinfI	GANTC	1 cut(s)	29
HphI	GGTGA	1 cut(s)	125
Hpy188I	TCNGA	1 cut(s)	82
HpyCH4V	TGCA	1 cut(s)	37
HpyF3I	CTNAG	1 cut(s)	81
LweI	GCATC	1 cut(s)	185
MaeI	CTAG	1 cut(s)	6
MlyI	GAGTC	1 cut(s)	38
MnlI	CCTC	1 cut(s)	159
MseI	TTAA	1 cut(s)	141
PleI	GAGTC	1 cut(s)	37
PpsI	GAGTC	1 cut(s)	37
SaqAI	TTAA	1 cut(s)	141
SchI	GAGTC	1 cut(s)	38
SetI	ASST	2 cut(s)	170, 182
SfaNI	GCATC	1 cut(s)	185
SsiI	CCGC	1 cut(s)	105
SspMI	CTAG	1 cut(s)	6
StyI	CCWWGG	1 cut(s)	100
TaqI	TCGA	1 cut(s)	173
Tru1I	TTAA	1 cut(s)	141
Tru9I	TTAA	1 cut(s)	141
XcmI	CCANNNNNNNNNTGG	1 cut(s)	107
XspI	CTAG	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.