Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr02

Orthogroup ID

OG0001337

Physical Location & Seq

Genomic Coordinates Reverse (-)

27633355 .. 27633683

Gene Structure 329 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD02G1230400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 237 bp

ATGAAGTATATTACAACAGAAAAAATAGAATTAGGAGAAAGAGATCAGAGCAATGAATGGGAAGGAAAAGAGAACCTAGAGTTGCCACTCTTCGACTGGAATGAAATAGTTAGTGTGACAGAAAACTTTTCAACCGAAAACAAGCTAGGAGAAAGTAGCTTTGGACCTGTTTACAGAGGGACACTAGCAGATGGACAAGAAATAGATGTGAAGAGGCTTTCTAGAAGTTCTGGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005886 GO:0005911 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0008150 GO:0008152 GO:0009506 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0019899 GO:0023052 GO:0030054 GO:0031625 GO:0036211 GO:0038023 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044389 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0055044 GO:0060089 GO:0065007 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin DUF3403 PAN_2 Pkinase_Tyr S_locus_glycop

Protein Analysis

79

Amino Acids

8.9

Weight (kDa)

4.48

Isoelectric Point (pI)

48.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001337)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g15100 FvH4_6g44105
malus_domestica	MD01G1096900.v1.1 MD02G1230400.v1.1 MD05G1226300.v1.1 MD09G1060000.v1.1 MD10G1207900.v1.1
prunus_persica	Prupe.1G289900_v2.0.a1
pyrus_communis	pycom04g03900 pycom05g20970 pycom10g17660
rosa_chinensis	RchiOBHm_Chr1g0314521 RchiOBHm_Chr1g0379221 RchiOBHm_Chr1g0379371 RchiOBHm_Chr1g0380681 RchiOBHm_Chr2g0114671 RchiOBHm_Chr4g0417601 RchiOBHm_Chr5g0025111 RchiOBHm_Chr5g0025141 RchiOBHm_Chr5g0025341 RchiOBHm_Chr5g0025391 RchiOBHm_Chr5g0025401 RchiOBHm_Chr5g0025431 RchiOBHm_Chr5g0026461 RchiOBHm_Chr5g0044581 RchiOBHm_Chr7g0196231 RchiOBHm_Chr7g0210551 RchiOBHm_Chr7g0210611
rosa_laevigata	RLG00000036334
rosa_multiflora	Rmu_co8021090.1_g000001 Rmu_co8025508.1_g000001 Rmu_co8173660.1_g000001 Rmu_sc0000936.1_g000004 Rmu_sc0005400.1_g000014 Rmu_sc0006827.1_g000017 Rmu_sc0034978.1_g000001
rosa_roxburghii	Rroxscaffold_1G00044210 Rroxscaffold_1G00053750 Rroxscaffold_1G00053800 Rroxscaffold_1G00053990 Rroxscaffold_1G00054530 Rroxscaffold_2G00089210 Rroxscaffold_2G00089260 Rroxscaffold_2G00089290 Rroxscaffold_2G00138080
rosa_rugosa	Rorug04G0436200
rosa_samantha	Rh5AG038500 Rh5AG038700 Rh5AG249800 Rh5BG471500 Rh5DG185400 Rh7AG216200 Rh7BG201000
rosa_wichuraiana	Rw5G016160

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	132
AjuI	GAANNNNNNNTTGG	2 cut(s)	144, 176
AluBI	AGCT	2 cut(s)	145, 159
AluI	AGCT	2 cut(s)	145, 159
AspS9I	GGNCC	1 cut(s)	164
AvaII	GGWCC	1 cut(s)	164
BccI	CCATC	1 cut(s)	185
BfaI	CTAG	4 cut(s)	77, 146, 185, 222
Bme18I	GGWCC	1 cut(s)	164
BmgT120I	GGNCC	1 cut(s)	164
Bse1I	ACTGG	1 cut(s)	101
Bse3DI	GCAATG	1 cut(s)	58
BseMI	GCAATG	1 cut(s)	58
BseNI	ACTGG	1 cut(s)	101
BslFI	GGGAC	1 cut(s)	193
BsmFI	GGGAC	1 cut(s)	193
Bsp143I	GATC	1 cut(s)	43
BsrDI	GCAATG	1 cut(s)	58
BsrI	ACTGG	1 cut(s)	101
BssMI	GATC	1 cut(s)	43
Bst6I	CTCTTC	2 cut(s)	95, 206
BstKTI	GATC	1 cut(s)	46
BstMBI	GATC	1 cut(s)	43
Cfr13I	GGNCC	1 cut(s)	164
CviJI	RGCY	3 cut(s)	145, 159, 217
CviKI_1	RGCY	3 cut(s)	145, 159, 217
DpnI	GATC	1 cut(s)	45
DpnII	GATC	1 cut(s)	43
Eam1104I	CTCTTC	2 cut(s)	95, 206
EarI	CTCTTC	2 cut(s)	95, 206
Eco47I	GGWCC	1 cut(s)	164
FaiI	YATR	1 cut(s)	9
FaqI	GGGAC	1 cut(s)	193
FspBI	CTAG	4 cut(s)	77, 146, 185, 222
Hpy166II	GTNNAC	1 cut(s)	172
Hpy188I	TCNGA	1 cut(s)	48
Hpy188III	TCNNGA	1 cut(s)	222
Hpy8I	GTNNAC	1 cut(s)	172
HpyAV	CCTTC	1 cut(s)	56
Kzo9I	GATC	1 cut(s)	43
LpnPI	CCDG	3 cut(s)	82, 180, 216
MaeI	CTAG	4 cut(s)	77, 146, 185, 222
MaeIII	GTNAC	1 cut(s)	115
MalI	GATC	1 cut(s)	45
MboI	GATC	1 cut(s)	43
MboII	GAAGA	2 cut(s)	82, 223
MluCI	AATT	1 cut(s)	29
MnlI	CCTC	2 cut(s)	170, 207
MseI	TTAA	1 cut(s)	235
NdeII	GATC	1 cut(s)	43
NmuCI	GTSAC	1 cut(s)	115
PspPI	GGNCC	1 cut(s)	164
SaqAI	TTAA	1 cut(s)	235
Sau3AI	GATC	1 cut(s)	43
Sau96I	GGNCC	1 cut(s)	164
SetI	ASST	4 cut(s)	78, 147, 161, 169
SgeI	CNNG	7 cut(s)	89, 109, 154, 158, 179, 197, 209
SinI	GGWCC	1 cut(s)	164
Sse9I	AATT	1 cut(s)	29
SspMI	CTAG	4 cut(s)	77, 146, 185, 222
TaqI	TCGA	1 cut(s)	93
TasI	AATT	1 cut(s)	29
Tru1I	TTAA	1 cut(s)	235
Tru9I	TTAA	1 cut(s)	235
TseFI	GTSAC	1 cut(s)	115
Tsp45I	GTSAC	1 cut(s)	115
TspDTI	ATGAA	3 cut(s)	17, 69, 117
VpaK11BI	GGWCC	1 cut(s)	164
XbaI	TCTAGA	1 cut(s)	221
XcmI	CCANNNNNNNNNTGG	1 cut(s)	93
XspI	CTAG	4 cut(s)	77, 146, 185, 222

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.