RchiOBHm_Chr1g0379221

divergent subfamily of APPLE domains

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
65320872 .. 65321207
336 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60257

Sequence Viewer

Length: 255 bp
ATGATTCATGATGACTATATCCACTATTCAGATGTTAGAAGATTGCTGGATTGCATAATGGATTACTGTGAAGAAGAAAGGGAAGACATGGAGTTGCCGCTATTTGACTTCACCACTATTGCTGATGCCACTGATAACTTTTCAAGCAACAACAAACTGGGACAAGGTGGCTTTGGACCTGTGTACAAGGGTACATTGATAGGAGGGAAAGAAATAGCTGTAAAGAGACGATCCAAGGAACCTGGTCAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

84

Amino Acids

9.59

Weight (kDa)

4.69

Isoelectric Point (pI)

62.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 98
AclWI GGATC 1 cut(s) 225
AfaI GTAC 2 cut(s) 185, 193
AgsI TTSAA 1 cut(s) 144
AjnI CCWGG 1 cut(s) 241
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
Alw26I GTCTC 1 cut(s) 220
AlwI GGATC 1 cut(s) 225
AspS9I GGNCC 1 cut(s) 176
AsuHPI GGTGA 1 cut(s) 103
AvaII GGWCC 1 cut(s) 176
BbsI GAAGAC 1 cut(s) 90
BciT130I CCWGG 1 cut(s) 243
BcoDI GTCTC 1 cut(s) 220
BisI GCNGC 1 cut(s) 98
BlsI GCNGC 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 243
Bme18I GGWCC 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 1 cut(s) 240
BmrFI CCNGG 1 cut(s) 243
BmrI ACTGGG 1 cut(s) 167
BmsI GCATC 1 cut(s) 115
BmuI ACTGGG 1 cut(s) 167
BpiI GAAGAC 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 234
Bse1I ACTGG 1 cut(s) 162
BseBI CCWGG 1 cut(s) 243
BseDI CCNNGG 1 cut(s) 234
BseNI ACTGG 1 cut(s) 162
BslFI GGGAC 1 cut(s) 174
BsmAI GTCTC 1 cut(s) 220
BsmBI CGTCTC 1 cut(s) 220
BsmFI GGGAC 1 cut(s) 174
Bsp1407I TGTACA 1 cut(s) 183
Bsp143I GATC 1 cut(s) 230
BspACI CCGC 1 cut(s) 98
BspHI TCATGA 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 240
BspPI GGATC 1 cut(s) 225
BsrGI TGTACA 1 cut(s) 183
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 1 cut(s) 234
BssMI GATC 1 cut(s) 230
BssT1I CCWWGG 1 cut(s) 234
Bst2UI CCWGG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 68
BstAUI TGTACA 1 cut(s) 183
BstKTI GATC 1 cut(s) 233
BstMAI GTCTC 1 cut(s) 220
BstMBI GATC 1 cut(s) 230
BstNI CCWGG 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 241
BstV2I GAAGAC 1 cut(s) 90
BtsIMutI CAGTG 1 cut(s) 129
CciI TCATGA 1 cut(s) 7
Cfr13I GGNCC 1 cut(s) 176
CsiI ACCWGGT 1 cut(s) 241
Csp6I GTAC 2 cut(s) 184, 192
CviAII CATG 2 cut(s) 8, 88
CviJI RGCY 2 cut(s) 171, 218
CviKI_1 RGCY 2 cut(s) 171, 218
CviQI GTAC 2 cut(s) 184, 192
DpnI GATC 1 cut(s) 232
DpnII GATC 1 cut(s) 230
Eco130I CCWWGG 1 cut(s) 234
Eco47I GGWCC 1 cut(s) 176
EcoRII CCWGG 1 cut(s) 241
EcoT14I CCWWGG 1 cut(s) 234
ErhI CCWWGG 1 cut(s) 234
Esp3I CGTCTC 1 cut(s) 220
FaeI CATG 2 cut(s) 11, 91
FaiI YATR 4 cut(s) 9, 18, 56, 89
FaqI GGGAC 1 cut(s) 174
FatI CATG 2 cut(s) 7, 87
Fnu4HI GCNGC 1 cut(s) 98
Fsp4HI GCNGC 1 cut(s) 98
GluI GCNGC 1 cut(s) 98
Hin1II CATG 2 cut(s) 11, 91
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 103
Hpy166II GTNNAC 1 cut(s) 184
Hpy188I TCNGA 1 cut(s) 31
Hpy188III TCNNGA 2 cut(s) 8, 248
Hpy8I GTNNAC 1 cut(s) 184
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 1 cut(s) 54
Hsp92II CATG 2 cut(s) 11, 91
Kzo9I GATC 1 cut(s) 230
LpnPI CCDG 4 cut(s) 32, 143, 192, 228
LweI GCATC 1 cut(s) 115
MabI ACCWGGT 1 cut(s) 241
MalI GATC 1 cut(s) 232
MboI GATC 1 cut(s) 230
MboII GAAGA 4 cut(s) 51, 83, 86, 95
MnlI CCTC 1 cut(s) 197
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
NdeII GATC 1 cut(s) 230
NlaIII CATG 2 cut(s) 11, 91
NlaIV GGNNCC 1 cut(s) 240
PagI TCATGA 1 cut(s) 7
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 1 cut(s) 99
Psp6I CCWGG 1 cut(s) 241
PspGI CCWGG 1 cut(s) 241
PspN4I GGNNCC 1 cut(s) 240
PspPI GGNCC 1 cut(s) 176
RsaI GTAC 2 cut(s) 185, 193
RsaNI GTAC 2 cut(s) 184, 192
SatI GCNGC 1 cut(s) 98
Sau3AI GATC 1 cut(s) 230
Sau96I GGNCC 1 cut(s) 176
ScrFI CCNGG 1 cut(s) 243
SetI ASST 4 cut(s) 169, 181, 220, 244
SexAI ACCWGGT 1 cut(s) 241
SfaNI GCATC 1 cut(s) 115
SgeI CNNG 9 cut(s) 20, 59, 100, 156, 170, 176, 191, 199, 247
SinI GGWCC 1 cut(s) 176
SsiI CCGC 1 cut(s) 98
StyD4I CCNGG 1 cut(s) 241
StyI CCWWGG 1 cut(s) 234
TaaI ACNGT 1 cut(s) 68
TatI WGTACW 1 cut(s) 183
TauI GCSGC 1 cut(s) 100
TfiI GAWTC 1 cut(s) 4
TscAI CASTG 1 cut(s) 136
TspRI CASTG 1 cut(s) 136
VpaK11BI GGWCC 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.