RchiOBHm_Chr5g0025111

serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001337
Physical Location & Seq
Forward (+)
19116889 .. 19117161
273 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30480

Sequence Viewer

Length: 273 bp
ATGCATGGTTTATCCATTCAGGGAAAATTGGTGACGGCACAAGAAATAGCTGTGAAGAAGGTTTCAAAAAATTCAAAGCAAGGAGCCTTAGAGTTTGAGAATGAATTGATACTCGTATATGAACTCCAACATACTAACCTTGTTCGGCTTTTTGGATTTTGCATTCATGGTGAAGAGAGGATGTTGATATATGAGTACATGCCAAACAAAAGTCTAGACTACTTTTTATTTGATAGGCAAGACTACTATCACTCAAATGTATATGTATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin PAN_2 Pkinase_Tyr

Protein Analysis

90

Amino Acids

10.65

Weight (kDa)

6.04

Isoelectric Point (pI)

39.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 12 - 81 5.2e-12 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 12 - 77 2.4e-08 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 70
AfaI GTAC 1 cut(s) 197
AgsI TTSAA 2 cut(s) 66, 75
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
ApoI RAATTY 1 cut(s) 70
AsuHPI GGTGA 2 cut(s) 43, 182
BceAI ACGGC 1 cut(s) 51
BfaI CTAG 2 cut(s) 215, 271
BmiI GGNNCC 1 cut(s) 85
BseGI GGATG 1 cut(s) 186
BsmI GAATGC 1 cut(s) 162
BspLI GGNNCC 1 cut(s) 85
Bst6I CTCTTC 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 88
BstF5I GGATG 1 cut(s) 186
BstNSI RCATGY 1 cut(s) 202
BtsCI GGATG 1 cut(s) 186
Csp6I GTAC 1 cut(s) 196
CviAII CATG 3 cut(s) 5, 167, 199
CviJI RGCY 3 cut(s) 50, 86, 148
CviKI_1 RGCY 3 cut(s) 50, 86, 148
CviQI GTAC 1 cut(s) 196
DdeI CTNAG 1 cut(s) 88
Eam1104I CTCTTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 168
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 3 cut(s) 8, 170, 202
FatI CATG 3 cut(s) 4, 166, 198
FokI GGATG 1 cut(s) 193
FspBI CTAG 2 cut(s) 215, 271
Hin1II CATG 3 cut(s) 8, 170, 202
HphI GGTGA 2 cut(s) 43, 182
Hpy188III TCNNGA 1 cut(s) 215
HpyAV CCTTC 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 4, 162
HpyF3I CTNAG 1 cut(s) 88
Hsp92II CATG 3 cut(s) 8, 170, 202
LmnI GCTCC 1 cut(s) 83
LpnPI CCDG 1 cut(s) 5
MaeI CTAG 2 cut(s) 215, 271
MaeIII GTNAC 1 cut(s) 31
MboII GAAGA 2 cut(s) 67, 185
MluCI AATT 3 cut(s) 26, 70, 104
MmeI TCCRAC 1 cut(s) 151
MnlI CCTC 1 cut(s) 171
Mph1103I ATGCAT 1 cut(s) 6
MslI CAYNNNNRTG 1 cut(s) 255
Mva1269I GAATGC 1 cut(s) 162
NlaIII CATG 3 cut(s) 8, 170, 202
NlaIV GGNNCC 1 cut(s) 85
NmuCI GTSAC 1 cut(s) 31
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 202
PctI GAATGC 1 cut(s) 162
PspN4I GGNNCC 1 cut(s) 85
RsaI GTAC 1 cut(s) 197
RsaNI GTAC 1 cut(s) 196
RseI CAYNNNNRTG 1 cut(s) 255
SetI ASST 3 cut(s) 52, 63, 141
SmiMI CAYNNNNRTG 1 cut(s) 255
Sse9I AATT 3 cut(s) 26, 70, 104
SspMI CTAG 2 cut(s) 215, 271
TasI AATT 3 cut(s) 26, 70, 104
TatI WGTACW 1 cut(s) 195
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 3 cut(s) 117, 135, 155
XapI RAATTY 1 cut(s) 70
XbaI TCTAGA 1 cut(s) 214
XceI RCATGY 1 cut(s) 202
XspI CTAG 2 cut(s) 215, 271
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.