RchiOBHm_Chr5g0025431

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
19331568 .. 19332330
763 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30509

Sequence Viewer

Length: 537 bp
ATGTTGATAAATGAGTACATGCCAAACAAAAGTTTGGACTACTTTTTATTTCATTCAACCAGAGCGCTGGTGCTAGATTGGAAGACGCGATTCAGTATAATAGAAGGAATCACTCAAGGAGTGCTGTACTTGCACAAGTACTCAAGAATGCAAGTGATTCATAGAGATTTGAAAGCTAGTAACATTCTACTTGATGAAAATATGAATCCTAAAATTTCTGATTTTGGTATGGCAAGAATCTTTACTCATAATGAACGGGAAGCAAAGACTAAGACAAAGAGGATTGTCGAGACATATGGTTACATGTCACCGGAGTATGTTATGGGGGAAATTTTTTACATAAAATCCGATCTGTATAGTTTTGGAGTACTAATGCTTGAGATCATAAGTGGTAGGAGAAACACAAGCTTCTACGATGATGATCGTGTGGTCAATACAGTGGGATATGTATGTGCATATATTAAGCAGATCTCTCTTAGTTTTAGTTTCCTGATGATCATAGTGTTCTTGCTGGATCTGCAGGCATGGGAGTTATAG

Protein Analysis

178

Amino Acids

20.98

Weight (kDa)

6.91

Isoelectric Point (pI)

42.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 1 - 146 6.3e-29 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 2 - 136 1e-27 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 88
AclWI GGATC 1 cut(s) 522
AcsI RAATTY 2 cut(s) 213, 330
AfaI GTAC 4 cut(s) 17, 128, 140, 369
AfeI AGCGCT 1 cut(s) 66
AflIII ACRYGT 1 cut(s) 303
AgsI TTSAA 2 cut(s) 57, 172
AluBI AGCT 2 cut(s) 176, 408
AluI AGCT 2 cut(s) 176, 408
Alw26I GTCTC 1 cut(s) 284
AlwI GGATC 1 cut(s) 522
Aor51HI AGCGCT 1 cut(s) 66
ApoI RAATTY 2 cut(s) 213, 330
AspLEI GCGC 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 300
BbsI GAAGAC 1 cut(s) 89
BclI TGATCA 1 cut(s) 495
BcoDI GTCTC 1 cut(s) 284
BfaI CTAG 2 cut(s) 74, 177
BfmI CTRYAG 1 cut(s) 518
BfoI RGCGCY 1 cut(s) 68
BglII AGATCT 1 cut(s) 468
BmcAI AGTACT 2 cut(s) 140, 369
BpiI GAAGAC 1 cut(s) 89
BpuEI CTTGAG 3 cut(s) 99, 127, 398
BsaBI GATNNNNATC 1 cut(s) 420
BsaWI WCCGGW 1 cut(s) 310
Bse8I GATNNNNATC 1 cut(s) 420
BseJI GATNNNNATC 1 cut(s) 420
Bsh1236I CGCG 1 cut(s) 88
BsiSI CCGG 1 cut(s) 311
BsmAI GTCTC 1 cut(s) 284
BsmI GAATGC 1 cut(s) 153
Bsp143I GATC 6 cut(s) 349, 381, 421, 468, 495, 514
BspFNI CGCG 1 cut(s) 88
BspMAI CTGCAG 1 cut(s) 522
BspPI GGATC 1 cut(s) 522
BssMI GATC 6 cut(s) 349, 381, 421, 468, 495, 514
Bst4CI ACNGT 1 cut(s) 439
BstC8I GCNNGC 1 cut(s) 522
BstDEI CTNAG 2 cut(s) 270, 476
BstFNI CGCG 1 cut(s) 88
BstH2I RGCGCY 1 cut(s) 68
BstHHI GCGC 1 cut(s) 67
BstKTI GATC 6 cut(s) 352, 384, 424, 471, 498, 517
BstMAI GTCTC 1 cut(s) 284
BstMBI GATC 6 cut(s) 349, 381, 421, 468, 495, 514
BstMWI GCNNNNNNNGC 2 cut(s) 130, 517
BstNSI RCATGY 2 cut(s) 22, 307
BstSFI CTRYAG 1 cut(s) 518
BstUI CGCG 1 cut(s) 88
BstV2I GAAGAC 1 cut(s) 89
BstX2I RGATCY 2 cut(s) 468, 514
BstXI CCANNNNNNTGG 1 cut(s) 67
BstYI RGATCY 2 cut(s) 468, 514
BtsIMutI CAGTG 1 cut(s) 444
Cac8I GCNNGC 1 cut(s) 522
CfoI GCGC 1 cut(s) 67
CseI GACGC 1 cut(s) 94
Csp6I GTAC 4 cut(s) 16, 127, 139, 368
CviAII CATG 3 cut(s) 19, 304, 525
CviJI RGCY 2 cut(s) 176, 408
CviKI_1 RGCY 2 cut(s) 176, 408
CviQI GTAC 4 cut(s) 16, 127, 139, 368
DdeI CTNAG 2 cut(s) 270, 476
DpnI GATC 6 cut(s) 351, 383, 423, 470, 497, 516
DpnII GATC 6 cut(s) 349, 381, 421, 468, 495, 514
Eco47III AGCGCT 1 cut(s) 66
FaeI CATG 3 cut(s) 22, 307, 528
FatI CATG 3 cut(s) 18, 303, 524
FauNDI CATATG 1 cut(s) 295
FbaI TGATCA 1 cut(s) 495
FspBI CTAG 2 cut(s) 74, 177
GlaI GCGC 1 cut(s) 66
HaeII RGCGCY 1 cut(s) 68
HapII CCGG 1 cut(s) 311
HgaI GACGC 1 cut(s) 94
HhaI GCGC 1 cut(s) 67
Hin1II CATG 3 cut(s) 22, 307, 528
Hin6I GCGC 1 cut(s) 65
HinP1I GCGC 1 cut(s) 65
HindIII AAGCTT 1 cut(s) 406
HinfI GANTC 5 cut(s) 90, 108, 157, 205, 237
HpaII CCGG 1 cut(s) 311
HphI GGTGA 1 cut(s) 300
Hpy188I TCNGA 2 cut(s) 220, 349
Hpy188III TCNNGA 3 cut(s) 144, 289, 490
HpyAV CCTTC 1 cut(s) 98
HpyCH4III ACNGT 1 cut(s) 439
HpyCH4V TGCA 4 cut(s) 133, 151, 455, 520
HpyF10VI GCNNNNNNNGC 2 cut(s) 130, 517
HpyF3I CTNAG 2 cut(s) 270, 476
Hsp92II CATG 3 cut(s) 22, 307, 528
HspAI GCGC 1 cut(s) 65
Ksp22I TGATCA 1 cut(s) 495
Kzo9I GATC 6 cut(s) 349, 381, 421, 468, 495, 514
LpnPI CCDG 6 cut(s) 53, 73, 324, 497, 503, 506
MaeI CTAG 2 cut(s) 74, 177
MaeIII GTNAC 3 cut(s) 179, 299, 306
MalI GATC 6 cut(s) 351, 383, 423, 470, 497, 516
MboI GATC 6 cut(s) 349, 381, 421, 468, 495, 514
MboII GAAGA 1 cut(s) 94
MflI RGATCY 2 cut(s) 468, 514
MluCI AATT 2 cut(s) 213, 330
MnlI CCTC 1 cut(s) 273
MseI TTAA 1 cut(s) 462
MspI CCGG 1 cut(s) 311
Mva1269I GAATGC 1 cut(s) 153
MvnI CGCG 1 cut(s) 88
MwoI GCNNNNNNNGC 2 cut(s) 130, 517
NdeI CATATG 1 cut(s) 295
NdeII GATC 6 cut(s) 349, 381, 421, 468, 495, 514
NlaIII CATG 3 cut(s) 22, 307, 528
NmuCI GTSAC 1 cut(s) 306
NspI RCATGY 2 cut(s) 22, 307
PciI ACATGT 1 cut(s) 303
PctI GAATGC 1 cut(s) 153
PfeI GAWTC 5 cut(s) 90, 108, 157, 205, 237
PscI ACATGT 1 cut(s) 303
PstI CTGCAG 1 cut(s) 522
PsuI RGATCY 2 cut(s) 468, 514
RsaI GTAC 4 cut(s) 17, 128, 140, 369
RsaNI GTAC 4 cut(s) 16, 127, 139, 368
SaqAI TTAA 1 cut(s) 462
Sau3AI GATC 6 cut(s) 349, 381, 421, 468, 495, 514
ScaI AGTACT 2 cut(s) 140, 369
SetI ASST 2 cut(s) 178, 410
SfcI CTRYAG 1 cut(s) 518
SmlI CTYRAG 3 cut(s) 114, 142, 377
SmoI CTYRAG 3 cut(s) 114, 142, 377
Sse9I AATT 2 cut(s) 213, 330
SspMI CTAG 2 cut(s) 74, 177
TaaI ACNGT 1 cut(s) 439
TaqI TCGA 1 cut(s) 288
TasI AATT 2 cut(s) 213, 330
TatI WGTACW 4 cut(s) 15, 126, 138, 367
TfiI GAWTC 5 cut(s) 90, 108, 157, 205, 237
Tru1I TTAA 1 cut(s) 462
Tru9I TTAA 1 cut(s) 462
TscAI CASTG 1 cut(s) 444
TseFI GTSAC 1 cut(s) 306
Tsp45I GTSAC 1 cut(s) 306
TspDTI ATGAA 5 cut(s) 41, 149, 210, 218, 267
TspRI CASTG 1 cut(s) 444
XapI RAATTY 2 cut(s) 213, 330
XceI RCATGY 2 cut(s) 22, 307
XspI CTAG 2 cut(s) 74, 177
ZrmI AGTACT 2 cut(s) 140, 369
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.