MD07G1039400.v1.1

Subtilisin-like serine endopeptidase family protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
3324014 .. 3324310
297 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1039400.v1.1.491

Sequence Viewer

Length: 297 bp
ATGGGAGCAAAAGTTATACCAATGAAATCATTTATGGTTACTTTTCCTAGAACAGTGAAAAATGTTAGCCCTGCAACCTCAACTTACAAGGCTAAAATCCTGCCAGGCCCTAAGGTTGACATCAAAGTGGTTCCTGAAGTTCTTTCGTTCAAGTCCTTGAATGAGGAAAAAAATTTCAATTTGACCATTGTTGGAACAGGTTTGCCAGATGGATCTCATATCTCCGCAGAGCTGATCTGGTCTGATGAAACTCATAGCATTAGAAGTCCAATTCTCATAAGCAGCTCAGTAATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

10.66

Weight (kDa)

9.4

Isoelectric Point (pI)

34.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
fn3_6 PF17766 10 - 93 3.7e-21 Fibronectin type-III domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 225
AclWI GGATC 1 cut(s) 220
AcsI RAATTY 1 cut(s) 172
AcuI CTGAAG 1 cut(s) 156
AgsI TTSAA 3 cut(s) 151, 160, 178
AjnI CCWGG 1 cut(s) 103
AluBI AGCT 2 cut(s) 232, 285
AluI AGCT 2 cut(s) 232, 285
AlwI GGATC 1 cut(s) 220
AoxI GGCC 1 cut(s) 106
ApeKI GCWGC 1 cut(s) 282
ApoI RAATTY 1 cut(s) 172
AspS9I GGNCC 1 cut(s) 107
AxyI CCTNAGG 1 cut(s) 111
BccI CCATC 1 cut(s) 203
BciT130I CCWGG 1 cut(s) 105
BfaI CTAG 1 cut(s) 48
BisI GCNGC 1 cut(s) 283
BlsI GCNGC 1 cut(s) 284
Bme1390I CCNGG 1 cut(s) 105
BmgT120I GGNCC 1 cut(s) 107
BmiI GGNNCC 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 105
BsaXI ACNNNNNCTCC 1 cut(s) 27
Bse21I CCTNAGG 1 cut(s) 111
BseBI CCWGG 1 cut(s) 105
BshFI GGCC 1 cut(s) 108
BsnI GGCC 1 cut(s) 108
Bsp143I GATC 2 cut(s) 212, 234
BspACI CCGC 1 cut(s) 225
BspANI GGCC 1 cut(s) 108
BspLI GGNNCC 1 cut(s) 132
BspPI GGATC 1 cut(s) 220
BssMI GATC 2 cut(s) 212, 234
Bst2UI CCWGG 1 cut(s) 105
Bst4CI ACNGT 1 cut(s) 55
BstDEI CTNAG 2 cut(s) 111, 286
BstKTI GATC 2 cut(s) 215, 237
BstMBI GATC 2 cut(s) 212, 234
BstNI CCWGG 1 cut(s) 105
BstSCI CCNGG 1 cut(s) 103
BstX2I RGATCY 1 cut(s) 212
BstYI RGATCY 1 cut(s) 212
Bsu36I CCTNAGG 1 cut(s) 111
BsuRI GGCC 1 cut(s) 108
BtsIMutI CAGTG 1 cut(s) 60
Cfr13I GGNCC 1 cut(s) 107
CviJI RGCY 5 cut(s) 69, 92, 108, 232, 285
CviKI_1 RGCY 5 cut(s) 69, 92, 108, 232, 285
DdeI CTNAG 2 cut(s) 111, 286
DpnI GATC 2 cut(s) 214, 236
DpnII GATC 2 cut(s) 212, 234
Eco57I CTGAAG 1 cut(s) 156
Eco81I CCTNAGG 1 cut(s) 111
EcoO109I RGGNCCY 1 cut(s) 107
EcoRII CCWGG 1 cut(s) 103
FaiI YATR 5 cut(s) 17, 35, 219, 255, 278
Fnu4HI GCNGC 1 cut(s) 283
Fsp4HI GCNGC 1 cut(s) 283
FspBI CTAG 1 cut(s) 48
GluI GCNGC 1 cut(s) 283
HaeIII GGCC 1 cut(s) 108
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 244
Hpy188III TCNNGA 1 cut(s) 134
Hpy8I GTNNAC 1 cut(s) 118
HpyCH4III ACNGT 1 cut(s) 55
HpyCH4V TGCA 1 cut(s) 74
HpyF3I CTNAG 2 cut(s) 111, 286
Kzo9I GATC 2 cut(s) 212, 234
LmnI GCTCC 1 cut(s) 5
LpnPI CCDG 8 cut(s) 84, 90, 113, 117, 147, 183, 219, 223
MaeI CTAG 1 cut(s) 48
MaeIII GTNAC 1 cut(s) 37
MalI GATC 2 cut(s) 214, 236
MboI GATC 2 cut(s) 212, 234
MflI RGATCY 1 cut(s) 212
MluCI AATT 3 cut(s) 172, 178, 270
MmeI TCCRAC 1 cut(s) 172
MnlI CCTC 2 cut(s) 88, 157
MslI CAYNNNNRTG 1 cut(s) 125
MspR9I CCNGG 1 cut(s) 105
MvaI CCWGG 1 cut(s) 105
NdeII GATC 2 cut(s) 212, 234
NlaIV GGNNCC 1 cut(s) 132
PkrI GCNGC 1 cut(s) 284
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspN4I GGNNCC 1 cut(s) 132
PspPI GGNCC 1 cut(s) 107
PsuI RGATCY 1 cut(s) 212
RseI CAYNNNNRTG 1 cut(s) 125
SatI GCNGC 1 cut(s) 283
Sau3AI GATC 2 cut(s) 212, 234
Sau96I GGNCC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 105
SetI ASST 5 cut(s) 80, 117, 202, 234, 287
SmiMI CAYNNNNRTG 1 cut(s) 125
Sse9I AATT 3 cut(s) 172, 178, 270
SsiI CCGC 1 cut(s) 225
SspMI CTAG 1 cut(s) 48
StyD4I CCNGG 1 cut(s) 103
TaaI ACNGT 1 cut(s) 55
TasI AATT 3 cut(s) 172, 178, 270
TscAI CASTG 1 cut(s) 60
TseI GCWGC 1 cut(s) 282
TspDTI ATGAA 2 cut(s) 38, 261
TspRI CASTG 1 cut(s) 60
XapI RAATTY 1 cut(s) 172
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.