RLG00000035887

Subtilisin-like serine endopeptidase family protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
73130844 .. 73131224
381 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000035887

Sequence Viewer

Length: 381 bp
ATGAAACCAGAGTTAGACTTGTATCAGGAGATAACGCCACATGCCCTACAGGGGTCTGACAAAGGATCACCAAGGAATCATAATTACCCATCAATGGGAGCTAAAGTTAAACCCATGGAATCATTTACTGTTGAGTTTAGTAGAAGAGTTAAACATTTTGGCCTTGCAAACTCCACTTACAAGGCCAAAATCTTCTCCACATCGAAACTTGATATCAAGGTGGTGCTTTCCTTCAAGTCCTTGAACGAGGAGAAGACTTTTAATATGACTGTTGTGGGGAGCAGTTTGCCAGTTGAATCACATGTCTCGGCATCATTGGTTTGGTCTGATGGTACTCACAGCGTTCGAAGTCCAATTGTTGTACATACAAGAAAGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.08

Weight (kDa)

9.56

Isoelectric Point (pI)

36.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
fn3_6 PF17766 27 - 121 4.2e-20 Fibronectin type-III domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 73
AfaI GTAC 2 cut(s) 334, 363
AfiI CCNNNNNNNGG 3 cut(s) 51, 94, 95
AflIII ACRYGT 1 cut(s) 301
AgsI TTSAA 3 cut(s) 235, 244, 296
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw26I GTCTC 1 cut(s) 310
AlwI GGATC 1 cut(s) 73
AoxI GGCC 2 cut(s) 160, 183
AsuHPI GGTGA 1 cut(s) 60
AsuII TTCGAA 1 cut(s) 346
BbsI GAAGAC 1 cut(s) 260
BccI CCATC 2 cut(s) 97, 323
BcoDI GTCTC 1 cut(s) 310
BfmI CTRYAG 1 cut(s) 47
BmsI GCATC 1 cut(s) 320
BpiI GAAGAC 1 cut(s) 260
Bpu14I TTCGAA 1 cut(s) 346
BsaJI CCNNGG 2 cut(s) 71, 114
BsaXI ACNNNNNCTCC 2 cut(s) 90, 120
Bsc4I CCNNNNNNNGG 3 cut(s) 51, 94, 95
Bse1I ACTGG 1 cut(s) 290
BseDI CCNNGG 2 cut(s) 71, 114
BseLI CCNNNNNNNGG 3 cut(s) 51, 94, 95
BseNI ACTGG 1 cut(s) 290
BseRI GAGGAG 1 cut(s) 263
BshFI GGCC 2 cut(s) 162, 185
BslI CCNNNNNNNGG 3 cut(s) 51, 94, 95
BsmAI GTCTC 1 cut(s) 310
BsnI GGCC 2 cut(s) 162, 185
Bsp119I TTCGAA 1 cut(s) 346
Bsp1407I TGTACA 1 cut(s) 361
Bsp143I GATC 1 cut(s) 65
Bsp19I CCATGG 1 cut(s) 114
BspANI GGCC 2 cut(s) 162, 185
BspPI GGATC 1 cut(s) 73
BspT104I TTCGAA 1 cut(s) 346
BsrGI TGTACA 1 cut(s) 361
BsrI ACTGG 1 cut(s) 290
BssECI CCNNGG 2 cut(s) 71, 114
BssMI GATC 1 cut(s) 65
BssT1I CCWWGG 2 cut(s) 71, 114
Bst4CI ACNGT 2 cut(s) 130, 271
Bst6I CTCTTC 1 cut(s) 139
BstAUI TGTACA 1 cut(s) 361
BstBI TTCGAA 1 cut(s) 346
BstDSI CCRYGG 1 cut(s) 114
BstKTI GATC 1 cut(s) 68
BstMAI GTCTC 1 cut(s) 310
BstMBI GATC 1 cut(s) 65
BstNSI RCATGY 2 cut(s) 44, 305
BstSFI CTRYAG 1 cut(s) 47
BstV2I GAAGAC 1 cut(s) 260
BsuRI GGCC 2 cut(s) 162, 185
BtgI CCRYGG 1 cut(s) 114
Csp6I GTAC 2 cut(s) 333, 362
CviAII CATG 3 cut(s) 41, 115, 302
CviJI RGCY 3 cut(s) 101, 162, 185
CviKI_1 RGCY 3 cut(s) 101, 162, 185
CviQI GTAC 2 cut(s) 333, 362
DpnI GATC 1 cut(s) 67
DpnII GATC 1 cut(s) 65
Eam1104I CTCTTC 1 cut(s) 139
EarI CTCTTC 1 cut(s) 139
Eco130I CCWWGG 2 cut(s) 71, 114
Eco32I GATATC 1 cut(s) 214
EcoRV GATATC 1 cut(s) 214
EcoT14I CCWWGG 2 cut(s) 71, 114
ErhI CCWWGG 2 cut(s) 71, 114
FaeI CATG 3 cut(s) 44, 118, 305
FaiI YATR 6 cut(s) 42, 81, 116, 266, 303, 366
FatI CATG 3 cut(s) 40, 114, 301
HaeIII GGCC 2 cut(s) 162, 185
Hin1II CATG 3 cut(s) 44, 118, 305
HinfI GANTC 3 cut(s) 76, 119, 296
HphI GGTGA 1 cut(s) 60
Hpy188I TCNGA 2 cut(s) 58, 328
Hpy188III TCNNGA 1 cut(s) 26
HpyAV CCTTC 1 cut(s) 241
HpyCH4III ACNGT 2 cut(s) 130, 271
HpyCH4V TGCA 1 cut(s) 167
Hsp92II CATG 3 cut(s) 44, 118, 305
Kzo9I GATC 1 cut(s) 65
LmnI GCTCC 2 cut(s) 98, 279
LpnPI CCDG 4 cut(s) 11, 21, 35, 303
LweI GCATC 1 cut(s) 320
MalI GATC 1 cut(s) 67
MboI GATC 1 cut(s) 65
MboII GAAGA 3 cut(s) 156, 184, 265
MfeI CAATTG 1 cut(s) 354
MluCI AATT 2 cut(s) 82, 354
MnlI CCTC 1 cut(s) 241
MseI TTAA 3 cut(s) 108, 150, 261
MunI CAATTG 1 cut(s) 354
NcoI CCATGG 1 cut(s) 114
NdeII GATC 1 cut(s) 65
NlaIII CATG 3 cut(s) 44, 118, 305
NmeAIII GCCGAG 1 cut(s) 287
NspI RCATGY 2 cut(s) 44, 305
NspV TTCGAA 1 cut(s) 346
PciI ACATGT 1 cut(s) 301
PfeI GAWTC 3 cut(s) 76, 119, 296
PscI ACATGT 1 cut(s) 301
RsaI GTAC 2 cut(s) 334, 363
RsaNI GTAC 2 cut(s) 333, 362
SaqAI TTAA 3 cut(s) 108, 150, 261
Sau3AI GATC 1 cut(s) 65
SetI ASST 2 cut(s) 103, 222
SfaNI GCATC 1 cut(s) 320
SfcI CTRYAG 1 cut(s) 47
SfuI TTCGAA 1 cut(s) 346
Sse9I AATT 2 cut(s) 82, 354
StyI CCWWGG 2 cut(s) 71, 114
TaaI ACNGT 2 cut(s) 130, 271
TaqI TCGA 2 cut(s) 203, 346
TasI AATT 2 cut(s) 82, 354
TatI WGTACW 1 cut(s) 361
TfiI GAWTC 3 cut(s) 76, 119, 296
Tru1I TTAA 3 cut(s) 108, 150, 261
Tru9I TTAA 3 cut(s) 108, 150, 261
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 2 cut(s) 44, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.