Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003418.1

Orthogroup ID

OG0001233

Physical Location & Seq

Genomic Coordinates Reverse (-)

17192 .. 17695

Gene Structure 504 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003418.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 504 bp

atgtcttgcctgcacgtggctggtgcaggagcatatgttaaagcaatccaccctgattgttgtccagcttccatcaaatcatctcttatatatgactacacagcttggccaatgaatattacagaaaatttcccaggtgaatttgcttttggatctggacatatcaatcctttaaaagctataaacccggggcttgagtatgaagcttctaaaaaagattacacaaagttgctctgcatgttgtttgatgagaccaaagtgagacttatatcaggagataacagcacttgttctgtaggctctgacacaggatcgccaaaggatcacaattacccttcaatggtagctattgttgcaccaatgacaccctttacggttagaagtcatagaagagctaaaaatgttgaccatgcaaactccacttacccggctaaaatctggtcaaattctcaagttgacatcaaattcatgcctgaaattcatgccttccaagtcattgaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Inhibitor_I9 PA Peptidase_S8

Protein Analysis

167

Amino Acids

18.39

Weight (kDa)

6.64

Isoelectric Point (pI)

42.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001233)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G59110
malus_domestica	MD02G1289000.v1.1 MD03G1083700.v1.1 MD03G1083900.v1.1 MD07G1037400.v1.1 MD07G1039400.v1.1
pyrus_communis	pycom03g06630 pycom11g07680 pycom11g07730
rosa_chinensis	RchiOBHm_Chr1g0323301 RchiOBHm_Chr1g0323331 RchiOBHm_Chr1g0323451
rosa_laevigata	RLG00000035887
rosa_multiflora	Rmu_co8214780.1_g000001 Rmu_co8240921.1_g000001 Rmu_co8297809.1_g000001 Rmu_co8485349.1_g000002 Rmu_sc0000507.1_g000014 Rmu_sc0001227.1_g000005 Rmu_sc0001449.1_g000008 Rmu_sc0002263.1_g000075 Rmu_sc0003418.1_g000006 Rmu_sc0012343.1_g000011 Rmu_sc0016895.1_g000001 Rmu_sc0034098.1_g000001
rosa_roxburghii	Rroxscaffold_4G00326170 Rroxscaffold_4G00326560 Rroxscaffold_4G00326630 Rroxscaffold_4G00326660
rosa_rugosa	Rorug01G0037500 Rorug05G0379400 Rorug05G0379400 Rorug05G0379500
rosa_samantha	Rh1AG054600 Rh1AG054800 Rh1AG055100 Rh1AG055400 Rh1AG059700 Rh1AG082800 Rh1BG050200 Rh1BG065700 Rh1CG055900 Rh1CG056100 Rh1CG057600 Rh1CG061500 Rh1DG059700 Rh1DG059800 Rh1DG060000 Rh1DG060300 Rh1DG061500 Rh1DG065600 Rh5AG439300 Rh5BG456000 Rh5BG456200 Rh5DG470700 Rh5DG471000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	160, 319, 330
AcoI	YGGCCR	1 cut(s)	107
AcsI	RAATTY	5 cut(s)	127, 140, 445, 464, 477
AcvI	CACGTG	1 cut(s)	16
AfiI	CCNNNNNNNGG	2 cut(s)	16, 340
AgsI	TTSAA	2 cut(s)	339, 500
AjnI	CCWGG	1 cut(s)	133
AjuI	GAANNNNNNNTTGG	2 cut(s)	132, 164
AluBI	AGCT	6 cut(s)	68, 104, 179, 206, 347, 395
AluI	AGCT	6 cut(s)	68, 104, 179, 206, 347, 395
Alw26I	GTCTC	2 cut(s)	245, 256
AlwI	GGATC	3 cut(s)	160, 319, 330
Ama87I	CYCGRG	1 cut(s)	187
AoxI	GGCC	1 cut(s)	107
ApoI	RAATTY	5 cut(s)	127, 140, 445, 464, 477
AsuC2I	CCSGG	3 cut(s)	188, 189, 428
AsuHPI	GGTGA	1 cut(s)	149
AvaI	CYCGRG	1 cut(s)	187
BalI	TGGCCA	1 cut(s)	109
BbrPI	CACGTG	1 cut(s)	16
BccI	CCATC	1 cut(s)	80
BciT130I	CCWGG	1 cut(s)	135
BcnI	CCSGG	3 cut(s)	188, 189, 428
BcoDI	GTCTC	2 cut(s)	245, 256
BfmI	CTRYAG	1 cut(s)	294
Bme1390I	CCNGG	4 cut(s)	135, 188, 189, 428
BmeT110I	CYCGRG	1 cut(s)	187
BmrFI	CCNGG	4 cut(s)	135, 188, 189, 428
BpuEI	CTTGAG	2 cut(s)	215, 435
BpuMI	CCSGG	3 cut(s)	188, 189, 428
BsaAI	YACGTR	1 cut(s)	16
BsaI	GGTCTC	1 cut(s)	245
BsaJI	CCNNGG	3 cut(s)	133, 187, 188
BsaXI	ACNNNNNCTCC	2 cut(s)	21, 51
Bsc4I	CCNNNNNNNGG	2 cut(s)	16, 340
BseBI	CCWGG	1 cut(s)	135
BseDI	CCNNGG	3 cut(s)	133, 187, 188
BseLI	CCNNNNNNNGG	2 cut(s)	16, 340
BsgI	GTGCAG	1 cut(s)	45
BshFI	GGCC	1 cut(s)	109
BsiHKCI	CYCGRG	1 cut(s)	187
BsiSI	CCGG	2 cut(s)	188, 428
BslI	CCNNNNNNNGG	2 cut(s)	16, 340
BsmAI	GTCTC	2 cut(s)	245, 256
BsnI	GGCC	1 cut(s)	109
Bso31I	GGTCTC	1 cut(s)	245
BsoBI	CYCGRG	1 cut(s)	187
Bsp143I	GATC	3 cut(s)	152, 311, 322
BspANI	GGCC	1 cut(s)	109
BspPI	GGATC	3 cut(s)	160, 319, 330
BspQI	GCTCTTC	1 cut(s)	385
BspTNI	GGTCTC	1 cut(s)	245
BssECI	CCNNGG	3 cut(s)	133, 187, 188
BssMI	GATC	3 cut(s)	152, 311, 322
Bst2UI	CCWGG	1 cut(s)	135
Bst4CI	ACNGT	1 cut(s)	376
Bst6I	CTCTTC	1 cut(s)	385
BstBAI	YACGTR	1 cut(s)	16
BstC8I	GCNNGC	1 cut(s)	11
BstKTI	GATC	3 cut(s)	155, 314, 325
BstMAI	GTCTC	2 cut(s)	245, 256
BstMBI	GATC	3 cut(s)	152, 311, 322
BstMWI	GCNNNNNNNGC	1 cut(s)	353
BstNI	CCWGG	1 cut(s)	135
BstNSI	RCATGY	1 cut(s)	241
BstSCI	CCNGG	4 cut(s)	133, 186, 187, 426
BstSFI	CTRYAG	1 cut(s)	294
BstX2I	RGATCY	1 cut(s)	152
BstYI	RGATCY	1 cut(s)	152
BsuRI	GGCC	1 cut(s)	109
Cac8I	GCNNGC	1 cut(s)	11
Cfr9I	CCCGGG	1 cut(s)	187
CspCI	CAANNNNNGTGG	2 cut(s)	38, 73
CviAII	CATG	4 cut(s)	238, 410, 469, 482
DpnI	GATC	3 cut(s)	154, 313, 324
DpnII	GATC	3 cut(s)	152, 311, 322
DraI	TTTAAA	1 cut(s)	174
EaeI	YGGCCR	1 cut(s)	107
Eam1104I	CTCTTC	1 cut(s)	385
EarI	CTCTTC	1 cut(s)	385
Eco31I	GGTCTC	1 cut(s)	245
Eco72I	CACGTG	1 cut(s)	16
Eco88I	CYCGRG	1 cut(s)	187
EcoRII	CCWGG	1 cut(s)	133
FaeI	CATG	4 cut(s)	241, 413, 472, 485
FalI	AAGNNNNNCTT	2 cut(s)	249, 281
FatI	CATG	4 cut(s)	237, 409, 468, 481
FauNDI	CATATG	1 cut(s)	34
HaeIII	GGCC	1 cut(s)	109
HapII	CCGG	2 cut(s)	188, 428
Hin1II	CATG	4 cut(s)	241, 413, 472, 485
HincII	GTYRAC	2 cut(s)	406, 457
HindII	GTYRAC	2 cut(s)	406, 457
HindIII	AAGCTT	1 cut(s)	204
HpaII	CCGG	2 cut(s)	188, 428
HphI	GGTGA	1 cut(s)	149
Hpy166II	GTNNAC	2 cut(s)	406, 457
Hpy188I	TCNGA	1 cut(s)	304
Hpy188III	TCNNGA	2 cut(s)	156, 273
Hpy8I	GTNNAC	2 cut(s)	406, 457
HpyAV	CCTTC	2 cut(s)	345, 496
HpyCH4III	ACNGT	1 cut(s)	376
HpyCH4IV	ACGT	1 cut(s)	15
HpyCH4V	TGCA	5 cut(s)	13, 26, 237, 356, 413
HpyF10VI	GCNNNNNNNGC	1 cut(s)	353
HpySE526I	ACGT	1 cut(s)	15
Hsp92II	CATG	4 cut(s)	241, 413, 472, 485
Kzo9I	GATC	3 cut(s)	152, 311, 322
LguI	GCTCTTC	1 cut(s)	385
LmnI	GCTCC	1 cut(s)	29
MaeII	ACGT	1 cut(s)	15
MalI	GATC	3 cut(s)	154, 313, 324
MboI	GATC	3 cut(s)	152, 311, 322
MboII	GAAGA	1 cut(s)	402
MflI	RGATCY	1 cut(s)	152
MlsI	TGGCCA	1 cut(s)	109
MluCI	AATT	6 cut(s)	127, 140, 328, 445, 464, 477
MluNI	TGGCCA	1 cut(s)	109
Mox20I	TGGCCA	1 cut(s)	109
MscI	TGGCCA	1 cut(s)	109
MseI	TTAA	2 cut(s)	39, 173
Msp20I	TGGCCA	1 cut(s)	109
MspI	CCGG	2 cut(s)	188, 428
MspR9I	CCNGG	4 cut(s)	135, 188, 189, 428
MvaI	CCWGG	1 cut(s)	135
MwoI	GCNNNNNNNGC	1 cut(s)	353
NciI	CCSGG	3 cut(s)	188, 189, 428
NdeI	CATATG	1 cut(s)	34
NdeII	GATC	3 cut(s)	152, 311, 322
NlaIII	CATG	4 cut(s)	241, 413, 472, 485
NspI	RCATGY	1 cut(s)	241
PciSI	GCTCTTC	1 cut(s)	385
PmaCI	CACGTG	1 cut(s)	16
PmlI	CACGTG	1 cut(s)	16
Ppu21I	YACGTR	1 cut(s)	16
Psp6I	CCWGG	1 cut(s)	133
PspCI	CACGTG	1 cut(s)	16
PspGI	CCWGG	1 cut(s)	133
PsuI	RGATCY	1 cut(s)	152
SapI	GCTCTTC	1 cut(s)	385
SaqAI	TTAA	2 cut(s)	39, 173
Sau3AI	GATC	3 cut(s)	152, 311, 322
ScrFI	CCNGG	4 cut(s)	135, 188, 189, 428
SetI	ASST	8 cut(s)	18, 70, 106, 139, 181, 208, 349, 397
SfcI	CTRYAG	1 cut(s)	294
SmaI	CCCGGG	1 cut(s)	189
SmlI	CTYRAG	2 cut(s)	194, 450
SmoI	CTYRAG	2 cut(s)	194, 450
Sse9I	AATT	6 cut(s)	127, 140, 328, 445, 464, 477
SspI	AATATT	1 cut(s)	118
StyD4I	CCNGG	4 cut(s)	133, 186, 187, 426
TaaI	ACNGT	1 cut(s)	376
TaiI	ACGT	1 cut(s)	18
TasI	AATT	6 cut(s)	127, 140, 328, 445, 464, 477
Tru1I	TTAA	2 cut(s)	39, 173
Tru9I	TTAA	2 cut(s)	39, 173
TspDTI	ATGAA	4 cut(s)	128, 216, 457, 470
TspMI	CCCGGG	1 cut(s)	187
XapI	RAATTY	5 cut(s)	127, 140, 445, 464, 477
XceI	RCATGY	1 cut(s)	241
XmaI	CCCGGG	1 cut(s)	187

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.