Rmu_co8240921.1_g000001

Subtilisin-like serine endopeptidase family protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8240921.1
Physical Location & Seq
Forward (+)
39 .. 443
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8240921.1_g000001.1.cds

Sequence Viewer

Length: 405 bp
atggactatgatgaagccaaagtgagactgatatcaggagataacagcacttgcccaacaggctctgataaaggatcaccaaaggatcttaactacccttcaatggctgcagcaaacgttacaccgaagaaaccttttatgattaactttcatagaacagttaaaaatgttggccttgcaaactctacttacaatgccaccatcttccaaagttccaaagacgtggatatcaaagttgtgcctgaatttctatccttcaagtccttgaatgaggagaagagctttgatgtggctgttgttggaaaaggtttggtaggtggatcactaatttcttcgtcactggtttggtctgatggtgttcataacgttaggagtccggttgtggtgcatactgaaatagcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

14.42

Weight (kDa)

6.82

Isoelectric Point (pI)

36.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 2 cut(s) 117, 366
AclWI GGATC 3 cut(s) 82, 93, 328
AcsI RAATTY 1 cut(s) 245
AfiI CCNNNNNNNGG 1 cut(s) 103
AgsI TTSAA 3 cut(s) 102, 259, 268
AjiI CACGTC 1 cut(s) 223
AluBI AGCT 1 cut(s) 282
AluI AGCT 1 cut(s) 282
Alw26I GTCTC 1 cut(s) 19
AlwI GGATC 3 cut(s) 82, 93, 328
AlwNI CAGNNNCTG 1 cut(s) 65
AoxI GGCC 1 cut(s) 172
ApeKI GCWGC 2 cut(s) 107, 110
ApoI RAATTY 1 cut(s) 245
AsuHPI GGTGA 1 cut(s) 69
BbvI GCAGC 2 cut(s) 94, 122
BccI CCATC 2 cut(s) 209, 347
BcoDI GTCTC 1 cut(s) 19
BfmI CTRYAG 1 cut(s) 108
BglI GCCNNNNNGGC 1 cut(s) 60
BisI GCNGC 2 cut(s) 108, 111
BlsI GCNGC 2 cut(s) 109, 112
BmgBI CACGTC 1 cut(s) 223
BsaWI WCCGGW 1 cut(s) 376
Bsc4I CCNNNNNNNGG 1 cut(s) 103
Bse1I ACTGG 1 cut(s) 345
BseLI CCNNNNNNNGG 1 cut(s) 103
BseNI ACTGG 1 cut(s) 345
BseRI GAGGAG 1 cut(s) 287
BseXI GCAGC 2 cut(s) 94, 122
BshFI GGCC 1 cut(s) 174
BsiSI CCGG 1 cut(s) 377
BslI CCNNNNNNNGG 1 cut(s) 103
BsmAI GTCTC 1 cut(s) 19
BsnI GGCC 1 cut(s) 174
Bsp143I GATC 3 cut(s) 74, 85, 320
BspANI GGCC 1 cut(s) 174
BspMAI CTGCAG 1 cut(s) 112
BspPI GGATC 3 cut(s) 82, 93, 328
BspQI GCTCTTC 1 cut(s) 272
BsrI ACTGG 1 cut(s) 345
BssMI GATC 3 cut(s) 74, 85, 320
Bst4CI ACNGT 1 cut(s) 160
Bst6I CTCTTC 1 cut(s) 272
BstKTI GATC 3 cut(s) 77, 88, 323
BstMAI GTCTC 1 cut(s) 19
BstMBI GATC 3 cut(s) 74, 85, 320
BstMWI GCNNNNNNNGC 1 cut(s) 60
BstSFI CTRYAG 1 cut(s) 108
BstV1I GCAGC 2 cut(s) 94, 122
BstX2I RGATCY 1 cut(s) 85
BstXI CCANNNNNNTGG 1 cut(s) 223
BstYI RGATCY 1 cut(s) 85
BsuRI GGCC 1 cut(s) 174
BtrI CACGTC 1 cut(s) 223
BtsIMutI CAGTG 1 cut(s) 338
CaiI CAGNNNCTG 1 cut(s) 65
CviJI RGCY 7 cut(s) 17, 63, 107, 174, 282, 293, 401
CviKI_1 RGCY 7 cut(s) 17, 63, 107, 174, 282, 293, 401
DpnI GATC 3 cut(s) 76, 87, 322
DpnII GATC 3 cut(s) 74, 85, 320
Eam1104I CTCTTC 1 cut(s) 272
EarI CTCTTC 1 cut(s) 272
Eco32I GATATC 2 cut(s) 33, 229
EcoRV GATATC 2 cut(s) 33, 229
FaiI YATR 5 cut(s) 9, 140, 153, 363, 390
Fnu4HI GCNGC 2 cut(s) 108, 111
Fsp4HI GCNGC 2 cut(s) 108, 111
GluI GCNGC 2 cut(s) 108, 111
HaeIII GGCC 1 cut(s) 174
HapII CCGG 1 cut(s) 377
HinfI GANTC 1 cut(s) 373
HpaII CCGG 1 cut(s) 377
HphI GGTGA 1 cut(s) 69
Hpy188I TCNGA 2 cut(s) 67, 352
Hpy188III TCNNGA 1 cut(s) 36
HpyAV CCTTC 2 cut(s) 108, 265
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4IV ACGT 3 cut(s) 117, 222, 366
HpyCH4V TGCA 3 cut(s) 110, 179, 388
HpyF10VI GCNNNNNNNGC 1 cut(s) 60
HpySE526I ACGT 3 cut(s) 117, 222, 366
Kzo9I GATC 3 cut(s) 74, 85, 320
LguI GCTCTTC 1 cut(s) 272
LpnPI CCDG 5 cut(s) 21, 45, 255, 326, 390
Lsp1109I GCAGC 2 cut(s) 94, 122
MaeII ACGT 3 cut(s) 117, 222, 366
MaeIII GTNAC 2 cut(s) 118, 336
MalI GATC 3 cut(s) 76, 87, 322
MboI GATC 3 cut(s) 74, 85, 320
MboII GAAGA 4 cut(s) 139, 196, 289, 324
MflI RGATCY 1 cut(s) 85
MluCI AATT 2 cut(s) 245, 327
MlyI GAGTC 1 cut(s) 382
MmeI TCCRAC 1 cut(s) 280
MnlI CCTC 1 cut(s) 265
MseI TTAA 3 cut(s) 90, 144, 162
MspI CCGG 1 cut(s) 377
MwoI GCNNNNNNNGC 1 cut(s) 60
NdeII GATC 3 cut(s) 74, 85, 320
NmuCI GTSAC 1 cut(s) 336
PciSI GCTCTTC 1 cut(s) 272
PkrI GCNGC 2 cut(s) 109, 112
PleI GAGTC 1 cut(s) 381
PpsI GAGTC 1 cut(s) 381
Psp1406I AACGTT 2 cut(s) 117, 366
PstI CTGCAG 1 cut(s) 112
PstNI CAGNNNCTG 1 cut(s) 65
PsuI RGATCY 1 cut(s) 85
SapI GCTCTTC 1 cut(s) 272
SaqAI TTAA 3 cut(s) 90, 144, 162
SatI GCNGC 2 cut(s) 108, 111
Sau3AI GATC 3 cut(s) 74, 85, 320
SchI GAGTC 1 cut(s) 382
SetI ASST 7 cut(s) 120, 136, 225, 284, 310, 319, 369
SfcI CTRYAG 1 cut(s) 108
Sse9I AATT 2 cut(s) 245, 327
TaaI ACNGT 1 cut(s) 160
TaiI ACGT 3 cut(s) 120, 225, 369
TasI AATT 2 cut(s) 245, 327
Tru1I TTAA 3 cut(s) 90, 144, 162
Tru9I TTAA 3 cut(s) 90, 144, 162
TscAI CASTG 1 cut(s) 345
TseFI GTSAC 1 cut(s) 336
TseI GCWGC 2 cut(s) 107, 110
Tsp45I GTSAC 1 cut(s) 336
TspDTI ATGAA 3 cut(s) 27, 140, 350
TspRI CASTG 1 cut(s) 345
XapI RAATTY 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.