Rroxscaffold_4G00326170

Subtilisin-like serine endopeptidase family protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
58156722 .. 58157145
424 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00326170.1

Sequence Viewer

Length: 390 bp
ATGCTTATGGATCGATCTGGACATATCAACCCTCTGAAAGCTATAGATCCGGGGTTTGTCTATGAAGATTCTAAAGAAGATTATATAAACTTTCTCTGCATGGTGTTCGATGAGGCTGATGTTAGACTTATTTCTGGACTGAACATGAATTGCCCACAAGCTTTGACAAAGGATTGCCAAAGGATCACAATTATCCTTCATTGGCATCTCCTTCATAGAACAGTTAAAAATGTTGGCCTTTCAAACTCTACATACAAGGCCAAAATCTTGCCAAATTCTGAGGTTGGCATCAAAGTGCTGCCTGAAGTTCTTTCCTTTAATTCACTGAATGAGGAAAAGACTTTCAATGTGACCACTGTCGGGAAAGCTTTGCAAGTTGGATCATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.53

Weight (kDa)

6.4

Isoelectric Point (pI)

31.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
fn3_6 PF17766 71 - 122 3e-11 Fibronectin type-III domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 18, 41, 191, 388
AcsI RAATTY 1 cut(s) 274
AcuI CTGAAG 1 cut(s) 324
AfiI CCNNNNNNNGG 1 cut(s) 360
AgsI TTSAA 2 cut(s) 243, 346
AluBI AGCT 3 cut(s) 41, 161, 368
AluI AGCT 3 cut(s) 41, 161, 368
AlwI GGATC 4 cut(s) 18, 41, 191, 388
AoxI GGCC 2 cut(s) 235, 258
ApeKI GCWGC 1 cut(s) 298
ApoI RAATTY 1 cut(s) 274
AsuC2I CCSGG 1 cut(s) 51
BbvI GCAGC 1 cut(s) 285
BcgI CGANNNNNNTGC 2 cut(s) 88, 122
BcnI CCSGG 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 42
BisI GCNGC 1 cut(s) 299
BlsI GCNGC 1 cut(s) 300
Bme1390I CCNGG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 51
BmsI GCATC 2 cut(s) 214, 297
BoxI GACNNNNGTC 1 cut(s) 356
BpuMI CCSGG 1 cut(s) 51
Bsa29I ATCGAT 1 cut(s) 13
BsaJI CCNNGG 1 cut(s) 50
Bsc4I CCNNNNNNNGG 1 cut(s) 360
BseCI ATCGAT 1 cut(s) 13
BseDI CCNNGG 1 cut(s) 50
BseLI CCNNNNNNNGG 1 cut(s) 360
BseMII CTCAG 1 cut(s) 270
BseXI GCAGC 1 cut(s) 285
BshFI GGCC 2 cut(s) 237, 260
BshVI ATCGAT 1 cut(s) 13
BsiSI CCGG 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 360
BsnI GGCC 2 cut(s) 237, 260
Bsp143I GATC 5 cut(s) 10, 14, 46, 183, 380
BspANI GGCC 2 cut(s) 237, 260
BspCNI CTCAG 1 cut(s) 271
BspDI ATCGAT 1 cut(s) 13
BspPI GGATC 4 cut(s) 18, 41, 191, 388
BssECI CCNNGG 1 cut(s) 50
BssMI GATC 5 cut(s) 10, 14, 46, 183, 380
Bst4CI ACNGT 2 cut(s) 223, 358
BstDEI CTNAG 1 cut(s) 279
BstKTI GATC 5 cut(s) 13, 17, 49, 186, 383
BstMBI GATC 5 cut(s) 10, 14, 46, 183, 380
BstPAI GACNNNNGTC 1 cut(s) 356
BstSCI CCNGG 1 cut(s) 49
BstSFI CTRYAG 1 cut(s) 42
BstV1I GCAGC 1 cut(s) 285
BstX2I RGATCY 1 cut(s) 46
BstYI RGATCY 1 cut(s) 46
Bsu15I ATCGAT 1 cut(s) 13
BsuRI GGCC 2 cut(s) 237, 260
BsuTUI ATCGAT 1 cut(s) 13
BtsIMutI CAGTG 2 cut(s) 323, 354
ClaI ATCGAT 1 cut(s) 13
CspCI CAANNNNNGTGG 2 cut(s) 144, 179
CviAII CATG 2 cut(s) 100, 145
CviJI RGCY 6 cut(s) 41, 116, 161, 237, 260, 368
CviKI_1 RGCY 6 cut(s) 41, 116, 161, 237, 260, 368
DdeI CTNAG 1 cut(s) 279
DpnI GATC 5 cut(s) 12, 16, 48, 185, 382
DpnII GATC 5 cut(s) 10, 14, 46, 183, 380
Eco57I CTGAAG 1 cut(s) 324
FaeI CATG 2 cut(s) 103, 148
FatI CATG 2 cut(s) 99, 144
Fnu4HI GCNGC 1 cut(s) 299
Fsp4HI GCNGC 1 cut(s) 299
GluI GCNGC 1 cut(s) 299
HaeIII GGCC 2 cut(s) 237, 260
HapII CCGG 1 cut(s) 50
Hin1II CATG 2 cut(s) 103, 148
HindIII AAGCTT 2 cut(s) 159, 366
HinfI GANTC 1 cut(s) 68
HpaII CCGG 1 cut(s) 50
Hpy188I TCNGA 2 cut(s) 36, 280
Hpy188III TCNNGA 3 cut(s) 18, 135, 361
HpyAV CCTTC 2 cut(s) 206, 221
HpyCH4III ACNGT 2 cut(s) 223, 358
HpyCH4V TGCA 2 cut(s) 99, 373
HpyF3I CTNAG 1 cut(s) 279
Hsp92II CATG 2 cut(s) 103, 148
Kzo9I GATC 5 cut(s) 10, 14, 46, 183, 380
LpnPI CCDG 4 cut(s) 3, 63, 120, 315
Lsp1109I GCAGC 1 cut(s) 285
LweI GCATC 2 cut(s) 214, 297
MaeIII GTNAC 1 cut(s) 349
MalI GATC 5 cut(s) 12, 16, 48, 185, 382
MboI GATC 5 cut(s) 10, 14, 46, 183, 380
MboII GAAGA 2 cut(s) 77, 89
MflI RGATCY 1 cut(s) 46
MluCI AATT 4 cut(s) 148, 189, 274, 319
MmeI TCCRAC 1 cut(s) 358
MnlI CCTC 4 cut(s) 42, 106, 274, 325
MseI TTAA 3 cut(s) 225, 318, 388
MslI CAYNNNNRTG 1 cut(s) 293
MspI CCGG 1 cut(s) 50
MspR9I CCNGG 1 cut(s) 51
NciI CCSGG 1 cut(s) 51
NdeII GATC 5 cut(s) 10, 14, 46, 183, 380
NlaIII CATG 2 cut(s) 103, 148
NmuCI GTSAC 1 cut(s) 349
PfeI GAWTC 1 cut(s) 68
PkrI GCNGC 1 cut(s) 300
PshAI GACNNNNGTC 1 cut(s) 356
PsuI RGATCY 1 cut(s) 46
RseI CAYNNNNRTG 1 cut(s) 293
SaqAI TTAA 3 cut(s) 225, 318, 388
SatI GCNGC 1 cut(s) 299
Sau3AI GATC 5 cut(s) 10, 14, 46, 183, 380
ScrFI CCNGG 1 cut(s) 51
SetI ASST 4 cut(s) 43, 163, 285, 370
SfaNI GCATC 2 cut(s) 214, 297
SfcI CTRYAG 1 cut(s) 42
SmiMI CAYNNNNRTG 1 cut(s) 293
Sse9I AATT 4 cut(s) 148, 189, 274, 319
StyD4I CCNGG 1 cut(s) 49
TaaI ACNGT 2 cut(s) 223, 358
TaqI TCGA 2 cut(s) 13, 108
TasI AATT 4 cut(s) 148, 189, 274, 319
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 3 cut(s) 225, 318, 388
Tru9I TTAA 3 cut(s) 225, 318, 388
TscAI CASTG 2 cut(s) 330, 361
TseFI GTSAC 1 cut(s) 349
TseI GCWGC 1 cut(s) 298
Tsp45I GTSAC 1 cut(s) 349
TspDTI ATGAA 4 cut(s) 78, 161, 188, 203
TspRI CASTG 2 cut(s) 330, 361
XapI RAATTY 1 cut(s) 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.