Rmu_sc0016895.1_g000001

Subtilisin-like serine endopeptidase family protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016895.1
Physical Location & Seq
Forward (+)
1 .. 352
352 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016895.1_g000001.1.cds

Sequence Viewer

Length: 352 bp
tggatctggacatatcattcctgtccaagctataaacccagggctggtttatgaagcttctaaggatgattacataaaactcctctgctcggtattgggagagggcgatgttagacttatatcaggagataacagcacttgccctccacactcggacaaagacgcgccaaaggatcacaattacccttcgctagcagctgttgttccaccaaataaagcttttactgtgaaatttcacagagtagttaaaaatgttggccttacaaactccactacagtgccaaaatcctcggaaacaacacttaagtggacatcaaagtggtgcctaaggttctttccttcgagtccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

12.59

Weight (kDa)

8.83

Isoelectric Point (pI)

38.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 322
AccII CGCG 1 cut(s) 165
AclWI GGATC 2 cut(s) 11, 181
AcsI RAATTY 1 cut(s) 231
AfiI CCNNNNNNNGG 2 cut(s) 44, 89
AflII CTTAAG 1 cut(s) 303
AjnI CCWGG 1 cut(s) 38
AleI CACNNNNGTG 2 cut(s) 276, 305
AluBI AGCT 4 cut(s) 30, 57, 198, 219
AluI AGCT 4 cut(s) 30, 57, 198, 219
AlwI GGATC 2 cut(s) 11, 181
AoxI GGCC 1 cut(s) 257
ApeKI GCWGC 1 cut(s) 195
ApoI RAATTY 1 cut(s) 231
AspLEI GCGC 1 cut(s) 167
AsuNHI GCTAGC 1 cut(s) 191
AxyI CCTNAGG 1 cut(s) 327
BanI GGYRCC 1 cut(s) 322
BbvI GCAGC 1 cut(s) 207
BciT130I CCWGG 1 cut(s) 40
BfaI CTAG 1 cut(s) 192
BfmI CTRYAG 1 cut(s) 274
BfrI CTTAAG 1 cut(s) 303
BisI GCNGC 1 cut(s) 196
BlsI GCNGC 1 cut(s) 197
Bme1390I CCNGG 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 324
BmrFI CCNGG 1 cut(s) 40
BmtI GCTAGC 1 cut(s) 195
BsaJI CCNNGG 3 cut(s) 38, 39, 289
BsaXI ACNNNNNCTCC 2 cut(s) 128, 158
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 89
Bse21I CCTNAGG 1 cut(s) 327
BseBI CCWGG 1 cut(s) 40
BseDI CCNNGG 3 cut(s) 38, 39, 289
BseGI GGATG 1 cut(s) 71
BseLI CCNNNNNNNGG 2 cut(s) 44, 89
BseRI GAGGAG 1 cut(s) 72
BseXI GCAGC 1 cut(s) 207
Bsh1236I CGCG 1 cut(s) 165
BshFI GGCC 1 cut(s) 259
BshNI GGYRCC 1 cut(s) 322
BslI CCNNNNNNNGG 2 cut(s) 44, 89
BsnI GGCC 1 cut(s) 259
Bsp143I GATC 2 cut(s) 3, 173
BspANI GGCC 1 cut(s) 259
BspFNI CGCG 1 cut(s) 165
BspLI GGNNCC 1 cut(s) 324
BspOI GCTAGC 1 cut(s) 195
BspPI GGATC 2 cut(s) 11, 181
BspT107I GGYRCC 1 cut(s) 322
BspTI CTTAAG 1 cut(s) 303
BssECI CCNNGG 3 cut(s) 38, 39, 289
BssMI GATC 2 cut(s) 3, 173
Bst2UI CCWGG 1 cut(s) 40
Bst4CI ACNGT 2 cut(s) 227, 278
BstAFI CTTAAG 1 cut(s) 303
BstC8I GCNNGC 1 cut(s) 193
BstDEI CTNAG 2 cut(s) 61, 327
BstF5I GGATG 1 cut(s) 71
BstFNI CGCG 1 cut(s) 165
BstHHI GCGC 1 cut(s) 167
BstKTI GATC 2 cut(s) 6, 176
BstMBI GATC 2 cut(s) 3, 173
BstNI CCWGG 1 cut(s) 40
BstSCI CCNGG 1 cut(s) 38
BstSFI CTRYAG 1 cut(s) 274
BstUI CGCG 1 cut(s) 165
BstV1I GCAGC 1 cut(s) 207
BstX2I RGATCY 1 cut(s) 3
BstYI RGATCY 1 cut(s) 3
Bsu36I CCTNAGG 1 cut(s) 327
BsuRI GGCC 1 cut(s) 259
BtgZI GCGATG 1 cut(s) 121
BtsCI GGATG 1 cut(s) 71
BtsIMutI CAGTG 1 cut(s) 283
Cac8I GCNNGC 1 cut(s) 193
CfoI GCGC 1 cut(s) 167
CseI GACGC 1 cut(s) 171
CviJI RGCY 6 cut(s) 30, 44, 57, 198, 219, 259
CviKI_1 RGCY 6 cut(s) 30, 44, 57, 198, 219, 259
DdeI CTNAG 2 cut(s) 61, 327
DpnI GATC 2 cut(s) 5, 175
DpnII GATC 2 cut(s) 3, 173
Eco81I CCTNAGG 1 cut(s) 327
EcoRII CCWGG 1 cut(s) 38
FaiI YATR 5 cut(s) 13, 33, 52, 75, 120
Fnu4HI GCNGC 1 cut(s) 196
FokI GGATG 1 cut(s) 78
Fsp4HI GCNGC 1 cut(s) 196
FspBI CTAG 1 cut(s) 192
GlaI GCGC 1 cut(s) 166
GluI GCNGC 1 cut(s) 196
HaeIII GGCC 1 cut(s) 259
HgaI GACGC 1 cut(s) 171
HhaI GCGC 1 cut(s) 167
Hin6I GCGC 1 cut(s) 165
HinP1I GCGC 1 cut(s) 165
HindIII AAGCTT 2 cut(s) 55, 217
HinfI GANTC 1 cut(s) 344
Hpy166II GTNNAC 1 cut(s) 310
Hpy188I TCNGA 2 cut(s) 155, 293
Hpy188III TCNNGA 2 cut(s) 7, 124
Hpy8I GTNNAC 1 cut(s) 310
HpyAV CCTTC 2 cut(s) 196, 349
HpyCH4III ACNGT 2 cut(s) 227, 278
HpyF3I CTNAG 2 cut(s) 61, 327
HspAI GCGC 1 cut(s) 165
Kzo9I GATC 2 cut(s) 3, 173
LpnPI CCDG 5 cut(s) 25, 30, 34, 52, 109
Lsp1109I GCAGC 1 cut(s) 207
MaeI CTAG 1 cut(s) 192
MalI GATC 2 cut(s) 5, 175
MboI GATC 2 cut(s) 3, 173
MflI RGATCY 1 cut(s) 3
MluCI AATT 2 cut(s) 179, 231
MnlI CCTC 4 cut(s) 93, 95, 154, 299
MseI TTAA 2 cut(s) 247, 304
MslI CAYNNNNRTG 3 cut(s) 276, 305, 317
MspA1I CMGCKG 1 cut(s) 198
MspCI CTTAAG 1 cut(s) 303
MspR9I CCNGG 1 cut(s) 40
MvaI CCWGG 1 cut(s) 40
MvnI CGCG 1 cut(s) 165
NdeII GATC 2 cut(s) 3, 173
NheI GCTAGC 1 cut(s) 191
NlaIV GGNNCC 1 cut(s) 324
OliI CACNNNNGTG 2 cut(s) 276, 305
PasI CCCWGGG 1 cut(s) 39
PkrI GCNGC 1 cut(s) 197
Psp6I CCWGG 1 cut(s) 38
PspGI CCWGG 1 cut(s) 38
PspN4I GGNNCC 1 cut(s) 324
PsuI RGATCY 1 cut(s) 3
PvuII CAGCTG 1 cut(s) 198
RseI CAYNNNNRTG 3 cut(s) 276, 305, 317
SaqAI TTAA 2 cut(s) 247, 304
SatI GCNGC 1 cut(s) 196
Sau3AI GATC 2 cut(s) 3, 173
ScrFI CCNGG 1 cut(s) 40
SetI ASST 5 cut(s) 32, 59, 200, 221, 333
SfcI CTRYAG 1 cut(s) 274
SmiMI CAYNNNNRTG 3 cut(s) 276, 305, 317
SmlI CTYRAG 1 cut(s) 303
SmoI CTYRAG 1 cut(s) 303
Sse9I AATT 2 cut(s) 179, 231
SspMI CTAG 1 cut(s) 192
StyD4I CCNGG 1 cut(s) 38
TaaI ACNGT 2 cut(s) 227, 278
TaqI TCGA 1 cut(s) 342
TasI AATT 2 cut(s) 179, 231
Tru1I TTAA 2 cut(s) 247, 304
Tru9I TTAA 2 cut(s) 247, 304
TscAI CASTG 1 cut(s) 283
TseI GCWGC 1 cut(s) 195
TspDTI ATGAA 1 cut(s) 67
TspRI CASTG 1 cut(s) 283
Vha464I CTTAAG 1 cut(s) 303
XapI RAATTY 1 cut(s) 231
XspI CTAG 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.