Rh1AG054600

Subtilisin-like serine endopeptidase family protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0001233
Physical Location & Seq
Reverse (-)
9021721 .. 9022272
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG054600.1

Sequence Viewer

Length: 552 bp
ATGAATCATACAACCAACAGCTCATGCCCGGGTGAATTTGCATATGGATCCGGTCATATCAATCCTCTAAAAGCTATTGACCCAGGGCTTGTGTATGATGCTTCTGCAGAGGATTATATTAAGTTACTCTGCTTGGACATGGACGAGGCGAGAGTCAGACTTATATCAGGAGATAACAGCACTTGTCCTACAGCTTCTGAACAAGGATCGGCAAAGGATCTCAACTACCCTTCAATATCAGCTATTGTTACACCAATGACACGTTTTACGGTGAAAATACGTAGAAGAGTTACAAATGTTGGCCTTGCAAATTCCACTTACAAGGCCGAAATCATGCCAAACTCTCAAGTTGAAATCAAAGTGGAGCCTCAAGTTCTTTCCTTCAAGTCCGTGAACGAGGAGAAGACTTTTGATTTGACCATTGTTGGAAGAGGTTTGCCAGATGGATCACATATGTCTTCGTCCTTGGTTTGGTCCGACGGAACTCATAAGGTTAAAAGTCCAGTTCTAGTGCAAAGCTTATCAGCAGCAGCATCATCACGGTTTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005576
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Inhibitor_I9 PA Peptidase_S8

Protein Analysis

183

Amino Acids

19.82

Weight (kDa)

6.51

Isoelectric Point (pI)

42.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
fn3_6 PF17766 73 - 171 1.4e-27 Fibronectin type-III domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 42, 55, 214, 225, 454
AcsI RAATTY 2 cut(s) 35, 310
AfiI CCNNNNNNNGG 1 cut(s) 471
AflIII ACRYGT 1 cut(s) 260
AgsI TTSAA 3 cut(s) 234, 353, 385
AjnI CCWGG 1 cut(s) 82
AluBI AGCT 5 cut(s) 21, 74, 194, 242, 519
AluI AGCT 5 cut(s) 21, 74, 194, 242, 519
AlwI GGATC 5 cut(s) 42, 55, 214, 225, 454
AlwNI CAGNNNCTG 1 cut(s) 197
Ama87I CYCGRG 1 cut(s) 28
AoxI GGCC 2 cut(s) 301, 324
ApeKI GCWGC 2 cut(s) 527, 530
ApoI RAATTY 2 cut(s) 35, 310
ArsI GACNNNNNNTTYG 2 cut(s) 397, 429
AspS9I GGNCC 1 cut(s) 474
AsuC2I CCSGG 2 cut(s) 29, 30
AsuHPI GGTGA 2 cut(s) 44, 283
AvaI CYCGRG 1 cut(s) 28
AvaII GGWCC 1 cut(s) 474
BamHI GGATCC 1 cut(s) 47
BbsI GAAGAC 2 cut(s) 410, 450
BbvI GCAGC 2 cut(s) 539, 542
BccI CCATC 1 cut(s) 437
BciT130I CCWGG 1 cut(s) 84
BcnI CCSGG 2 cut(s) 29, 30
BfaI CTAG 1 cut(s) 509
BfmI CTRYAG 2 cut(s) 105, 189
BisI GCNGC 2 cut(s) 528, 531
BlsI GCNGC 2 cut(s) 529, 532
Bme1390I CCNGG 3 cut(s) 29, 30, 84
Bme18I GGWCC 1 cut(s) 474
BmeT110I CYCGRG 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 474
BmiI GGNNCC 2 cut(s) 49, 366
BmrFI CCNGG 3 cut(s) 29, 30, 84
BmsI GCATC 2 cut(s) 88, 542
BpiI GAAGAC 2 cut(s) 410, 450
BpuEI CTTGAG 2 cut(s) 330, 354
BpuMI CCSGG 2 cut(s) 29, 30
BsaAI YACGTR 1 cut(s) 281
BsaJI CCNNGG 4 cut(s) 28, 82, 83, 465
BsaWI WCCGGW 1 cut(s) 50
Bsc4I CCNNNNNNNGG 1 cut(s) 471
Bse1I ACTGG 1 cut(s) 503
BseBI CCWGG 1 cut(s) 84
BseDI CCNNGG 4 cut(s) 28, 82, 83, 465
BseLI CCNNNNNNNGG 1 cut(s) 471
BseNI ACTGG 1 cut(s) 503
BseRI GAGGAG 1 cut(s) 413
BseXI GCAGC 2 cut(s) 539, 542
BshFI GGCC 2 cut(s) 303, 326
BsiHKCI CYCGRG 1 cut(s) 28
BsiSI CCGG 2 cut(s) 29, 51
BslI CCNNNNNNNGG 1 cut(s) 471
BsnI GGCC 2 cut(s) 303, 326
BsoBI CYCGRG 1 cut(s) 28
Bsp143I GATC 4 cut(s) 47, 206, 217, 446
BspANI GGCC 2 cut(s) 303, 326
BspLI GGNNCC 2 cut(s) 49, 366
BspMAI CTGCAG 1 cut(s) 109
BspPI GGATC 5 cut(s) 42, 55, 214, 225, 454
BsrI ACTGG 1 cut(s) 503
BssECI CCNNGG 4 cut(s) 28, 82, 83, 465
BssMI GATC 4 cut(s) 47, 206, 217, 446
BssT1I CCWWGG 1 cut(s) 465
Bst2UI CCWGG 1 cut(s) 84
Bst4CI ACNGT 2 cut(s) 271, 543
Bst6I CTCTTC 2 cut(s) 280, 424
BstBAI YACGTR 1 cut(s) 281
BstKTI GATC 4 cut(s) 50, 209, 220, 449
BstMBI GATC 4 cut(s) 47, 206, 217, 446
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 3 cut(s) 27, 28, 82
BstSFI CTRYAG 2 cut(s) 105, 189
BstSNI TACGTA 1 cut(s) 281
BstV1I GCAGC 2 cut(s) 539, 542
BstV2I GAAGAC 2 cut(s) 410, 450
BstX2I RGATCY 2 cut(s) 47, 217
BstYI RGATCY 2 cut(s) 47, 217
BsuRI GGCC 2 cut(s) 303, 326
CaiI CAGNNNCTG 1 cut(s) 197
Cfr13I GGNCC 1 cut(s) 474
Cfr9I CCCGGG 1 cut(s) 28
CviAII CATG 3 cut(s) 24, 139, 334
CviJI RGCY 9 cut(s) 21, 74, 88, 194, 242, 303, 326, 367, 519
CviKI_1 RGCY 9 cut(s) 21, 74, 88, 194, 242, 303, 326, 367, 519
DpnI GATC 4 cut(s) 49, 208, 219, 448
DpnII GATC 4 cut(s) 47, 206, 217, 446
Eam1104I CTCTTC 2 cut(s) 280, 424
EarI CTCTTC 2 cut(s) 280, 424
Eco105I TACGTA 1 cut(s) 281
Eco130I CCWWGG 1 cut(s) 465
Eco47I GGWCC 1 cut(s) 474
Eco88I CYCGRG 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 82
EcoT14I CCWWGG 1 cut(s) 465
ErhI CCWWGG 1 cut(s) 465
FaeI CATG 3 cut(s) 27, 142, 337
FatI CATG 3 cut(s) 23, 138, 333
FauNDI CATATG 2 cut(s) 43, 453
Fnu4HI GCNGC 2 cut(s) 528, 531
Fsp4HI GCNGC 2 cut(s) 528, 531
FspBI CTAG 1 cut(s) 509
GluI GCNGC 2 cut(s) 528, 531
HaeIII GGCC 2 cut(s) 303, 326
HapII CCGG 2 cut(s) 29, 51
Hin1II CATG 3 cut(s) 27, 142, 337
HindIII AAGCTT 1 cut(s) 517
HinfI GANTC 2 cut(s) 4, 153
HpaII CCGG 2 cut(s) 29, 51
HphI GGTGA 2 cut(s) 44, 283
Hpy166II GTNNAC 1 cut(s) 394
Hpy188I TCNGA 3 cut(s) 158, 199, 478
Hpy188III TCNNGA 1 cut(s) 168
Hpy8I GTNNAC 1 cut(s) 394
Hpy99I CGWCG 1 cut(s) 482
HpyAV CCTTC 2 cut(s) 240, 391
HpyCH4III ACNGT 2 cut(s) 271, 543
HpyCH4IV ACGT 2 cut(s) 262, 280
HpyCH4V TGCA 4 cut(s) 41, 107, 308, 514
HpySE526I ACGT 2 cut(s) 262, 280
Hsp92II CATG 3 cut(s) 27, 142, 337
Kzo9I GATC 4 cut(s) 47, 206, 217, 446
LmnI GCTCC 1 cut(s) 364
LpnPI CCDG 7 cut(s) 42, 64, 69, 96, 153, 453, 516
Lsp1109I GCAGC 2 cut(s) 539, 542
LweI GCATC 2 cut(s) 88, 542
MaeI CTAG 1 cut(s) 509
MaeII ACGT 2 cut(s) 262, 280
MaeIII GTNAC 3 cut(s) 123, 247, 289
MalI GATC 4 cut(s) 49, 208, 219, 448
MboI GATC 4 cut(s) 47, 206, 217, 446
MboII GAAGA 4 cut(s) 297, 415, 441, 450
MflI RGATCY 2 cut(s) 47, 217
MluCI AATT 2 cut(s) 35, 310
MlyI GAGTC 1 cut(s) 162
MmeI TCCRAC 2 cut(s) 406, 501
MnlI CCTC 6 cut(s) 75, 103, 139, 378, 391, 425
MseI TTAA 3 cut(s) 120, 495, 550
MspI CCGG 2 cut(s) 29, 51
MspR9I CCNGG 3 cut(s) 29, 30, 84
MvaI CCWGG 1 cut(s) 84
NciI CCSGG 2 cut(s) 29, 30
NdeI CATATG 2 cut(s) 43, 453
NdeII GATC 4 cut(s) 47, 206, 217, 446
NlaIII CATG 3 cut(s) 27, 142, 337
NlaIV GGNNCC 2 cut(s) 49, 366
PasI CCCWGGG 1 cut(s) 83
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 2 cut(s) 529, 532
PleI GAGTC 1 cut(s) 161
PpsI GAGTC 1 cut(s) 161
Ppu21I YACGTR 1 cut(s) 281
Psp6I CCWGG 1 cut(s) 82
PspGI CCWGG 1 cut(s) 82
PspN4I GGNNCC 2 cut(s) 49, 366
PspPI GGNCC 1 cut(s) 474
PstI CTGCAG 1 cut(s) 109
PstNI CAGNNNCTG 1 cut(s) 197
PsuI RGATCY 2 cut(s) 47, 217
SaqAI TTAA 3 cut(s) 120, 495, 550
SatI GCNGC 2 cut(s) 528, 531
Sau3AI GATC 4 cut(s) 47, 206, 217, 446
Sau96I GGNCC 1 cut(s) 474
SchI GAGTC 1 cut(s) 162
ScrFI CCNGG 3 cut(s) 29, 30, 84
SetI ASST 9 cut(s) 23, 76, 196, 244, 265, 283, 436, 495, 521
SfaNI GCATC 2 cut(s) 88, 542
SfcI CTRYAG 2 cut(s) 105, 189
SinI GGWCC 1 cut(s) 474
SmaI CCCGGG 1 cut(s) 30
SmlI CTYRAG 2 cut(s) 345, 369
SmoI CTYRAG 2 cut(s) 345, 369
SnaBI TACGTA 1 cut(s) 281
Sse9I AATT 2 cut(s) 35, 310
SspMI CTAG 1 cut(s) 509
StyD4I CCNGG 3 cut(s) 27, 28, 82
StyI CCWWGG 1 cut(s) 465
TaaI ACNGT 2 cut(s) 271, 543
TaiI ACGT 2 cut(s) 265, 283
TasI AATT 2 cut(s) 35, 310
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 3 cut(s) 120, 495, 550
Tru9I TTAA 3 cut(s) 120, 495, 550
TseI GCWGC 2 cut(s) 527, 530
TspDTI ATGAA 2 cut(s) 17, 536
TspGWI ACGGA 2 cut(s) 379, 495
TspMI CCCGGG 1 cut(s) 28
VpaK11BI GGWCC 1 cut(s) 474
XapI RAATTY 2 cut(s) 35, 310
XmaI CCCGGG 1 cut(s) 28
XspI CTAG 1 cut(s) 509
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.