MD12G1094900.v1.1

Dip2/Utp12 Family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Reverse (-)
12816287 .. 12817946
1660 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1094900.v1.1.491

Sequence Viewer

Length: 471 bp
ATGAAGAGTAAAAAGGGAAGCAAGGCACGTGCAAAAGACATGGTTAAAGATAATGGCATGGTTGACATTGAACCAGAAGATTTGCCAATCAAGTCTAAAAAGGGCAGTAATAAGCGTGCTACAGCACCGGATTCGAATCCTCCAACTGTCAAAGACATCCTTGAAATTGGTCATGTGGAGGATGCAGATGGAGTTCTTGTTGATGATGACTTGAATGAACCAACCATGGGAGAAAAACTTGGAAGTTTAAATTTATTAGACAATGCTAGACCAGAGAGCCATGATAAAGAAGAATCTTCTCTCGATCCAAAGCCTCTAAGTGCAGACTCAATTCATGTTTTACTCAAGAAAGCACTACATGCCAATGACTGTGCCCTTTTATTAGATTGCTTATACACCCAAGATGAGAAGGTTGTAGCTCTCGTAGTTCATATTGGTTATATAATACTTATGCATGAAGATAAGTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

157

Amino Acids

17.06

Weight (kDa)

5.09

Isoelectric Point (pI)

39.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 299
AcsI RAATTY 1 cut(s) 250
AcvI CACGTG 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 227
AgsI TTSAA 3 cut(s) 71, 164, 214
AluBI AGCT 1 cut(s) 419
AluI AGCT 1 cut(s) 419
AlwI GGATC 1 cut(s) 299
ApoI RAATTY 1 cut(s) 250
AsuII TTCGAA 1 cut(s) 134
BaeGI GKGCMC 1 cut(s) 376
BbrPI CACGTG 1 cut(s) 29
BccI CCATC 1 cut(s) 182
BcgI CGANNNNNNTGC 2 cut(s) 114, 148
BfaI CTAG 1 cut(s) 267
BfmI CTRYAG 1 cut(s) 120
BmsI GCATC 1 cut(s) 172
Bpu14I TTCGAA 1 cut(s) 134
BpuEI CTTGAG 1 cut(s) 329
BsaAI YACGTR 1 cut(s) 29
BsaBI GATNNNNATC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 225
BsaWI WCCGGW 1 cut(s) 127
BsaXI ACNNNNNCTCC 2 cut(s) 183, 213
Bsc4I CCNNNNNNNGG 1 cut(s) 227
Bse8I GATNNNNATC 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 225
BseGI GGATG 2 cut(s) 156, 187
BseJI GATNNNNATC 1 cut(s) 135
BseLI CCNNNNNNNGG 1 cut(s) 227
BseSI GKGCMC 1 cut(s) 376
BsgI GTGCAG 1 cut(s) 342
BsiSI CCGG 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 227
Bsp119I TTCGAA 1 cut(s) 134
Bsp1286I GDGCHC 1 cut(s) 376
Bsp143I GATC 1 cut(s) 304
Bsp19I CCATGG 1 cut(s) 225
BspPI GGATC 1 cut(s) 299
BspT104I TTCGAA 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 225
BssMI GATC 1 cut(s) 304
BssT1I CCWWGG 1 cut(s) 225
Bst4CI ACNGT 2 cut(s) 148, 371
BstAPI GCANNNNNTGC 1 cut(s) 359
BstBAI YACGTR 1 cut(s) 29
BstBI TTCGAA 1 cut(s) 134
BstC8I GCNNGC 1 cut(s) 117
BstDEI CTNAG 1 cut(s) 317
BstDSI CCRYGG 1 cut(s) 225
BstF5I GGATG 2 cut(s) 156, 187
BstKTI GATC 1 cut(s) 307
BstMBI GATC 1 cut(s) 304
BstMWI GCNNNNNNNGC 1 cut(s) 359
BstNSI RCATGY 1 cut(s) 362
BstSFI CTRYAG 1 cut(s) 120
BstSLI GKGCMC 1 cut(s) 376
BtgI CCRYGG 1 cut(s) 225
BtsCI GGATG 2 cut(s) 156, 187
Cac8I GCNNGC 1 cut(s) 117
CviAII CATG 8 cut(s) 40, 58, 173, 226, 281, 335, 359, 455
CviJI RGCY 3 cut(s) 279, 313, 419
CviKI_1 RGCY 3 cut(s) 279, 313, 419
DdeI CTNAG 1 cut(s) 317
DpnI GATC 1 cut(s) 306
DpnII GATC 1 cut(s) 304
DraI TTTAAA 1 cut(s) 249
Eco130I CCWWGG 1 cut(s) 225
Eco72I CACGTG 1 cut(s) 29
EcoT14I CCWWGG 1 cut(s) 225
EcoT22I ATGCAT 1 cut(s) 456
ErhI CCWWGG 1 cut(s) 225
FaeI CATG 8 cut(s) 43, 61, 176, 229, 284, 338, 362, 458
FalI AAGNNNNNCTT 2 cut(s) 144, 176
FatI CATG 8 cut(s) 39, 57, 172, 225, 280, 334, 358, 454
FokI GGATG 2 cut(s) 143, 194
FspBI CTAG 1 cut(s) 267
HapII CCGG 1 cut(s) 128
Hin1II CATG 8 cut(s) 43, 61, 176, 229, 284, 338, 362, 458
HincII GTYRAC 1 cut(s) 64
HindII GTYRAC 1 cut(s) 64
HinfI GANTC 4 cut(s) 131, 136, 293, 326
HpaII CCGG 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 64
Hpy188III TCNNGA 2 cut(s) 302, 346
Hpy8I GTNNAC 1 cut(s) 64
HpyAV CCTTC 1 cut(s) 403
HpyCH4III ACNGT 2 cut(s) 148, 371
HpyCH4IV ACGT 1 cut(s) 28
HpyCH4V TGCA 4 cut(s) 32, 185, 323, 454
HpyF10VI GCNNNNNNNGC 1 cut(s) 359
HpyF3I CTNAG 1 cut(s) 317
HpySE526I ACGT 1 cut(s) 28
Hsp92II CATG 8 cut(s) 43, 61, 176, 229, 284, 338, 362, 458
Kzo9I GATC 1 cut(s) 304
LpnPI CCDG 3 cut(s) 87, 141, 285
LweI GCATC 1 cut(s) 172
MaeI CTAG 1 cut(s) 267
MaeII ACGT 1 cut(s) 28
MalI GATC 1 cut(s) 306
MboI GATC 1 cut(s) 304
MboII GAAGA 5 cut(s) 16, 89, 288, 302, 470
MhlI GDGCHC 1 cut(s) 376
MluCI AATT 3 cut(s) 165, 250, 330
MlyI GAGTC 1 cut(s) 320
MmeI TCCRAC 1 cut(s) 167
MnlI CCTC 3 cut(s) 150, 172, 324
Mph1103I ATGCAT 1 cut(s) 456
MseI TTAA 3 cut(s) 45, 248, 469
MslI CAYNNNNRTG 1 cut(s) 363
MspI CCGG 1 cut(s) 128
MwoI GCNNNNNNNGC 1 cut(s) 359
NcoI CCATGG 1 cut(s) 225
NdeII GATC 1 cut(s) 304
NlaIII CATG 8 cut(s) 43, 61, 176, 229, 284, 338, 362, 458
NsiI ATGCAT 1 cut(s) 456
NspI RCATGY 1 cut(s) 362
NspV TTCGAA 1 cut(s) 134
PfeI GAWTC 3 cut(s) 131, 136, 293
PleI GAGTC 1 cut(s) 320
PmaCI CACGTG 1 cut(s) 29
PmlI CACGTG 1 cut(s) 29
PpsI GAGTC 1 cut(s) 320
Ppu21I YACGTR 1 cut(s) 29
PspCI CACGTG 1 cut(s) 29
RseI CAYNNNNRTG 1 cut(s) 363
SaqAI TTAA 3 cut(s) 45, 248, 469
Sau3AI GATC 1 cut(s) 304
SchI GAGTC 1 cut(s) 320
SduI GDGCHC 1 cut(s) 376
SetI ASST 3 cut(s) 31, 414, 421
SfaNI GCATC 1 cut(s) 172
SfcI CTRYAG 1 cut(s) 120
SfuI TTCGAA 1 cut(s) 134
SmiMI CAYNNNNRTG 1 cut(s) 363
SmlI CTYRAG 1 cut(s) 344
SmoI CTYRAG 1 cut(s) 344
Sse9I AATT 3 cut(s) 165, 250, 330
SspMI CTAG 1 cut(s) 267
StyI CCWWGG 1 cut(s) 225
TaaI ACNGT 2 cut(s) 148, 371
TaiI ACGT 1 cut(s) 31
TaqI TCGA 2 cut(s) 134, 303
TasI AATT 3 cut(s) 165, 250, 330
TfiI GAWTC 3 cut(s) 131, 136, 293
Tru1I TTAA 3 cut(s) 45, 248, 469
Tru9I TTAA 3 cut(s) 45, 248, 469
TspDTI ATGAA 5 cut(s) 17, 231, 323, 419, 471
XapI RAATTY 1 cut(s) 250
XceI RCATGY 1 cut(s) 362
XspI CTAG 1 cut(s) 267
Zsp2I ATGCAT 1 cut(s) 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.