Rmu_ssc0000432.1_g000074

Dip2/Utp12 Family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000432.1
Physical Location & Seq
Reverse (-)
259235 .. 260756
1522 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000432.1_g000074.1.cds

Sequence Viewer

Length: 729 bp
atgcatgttatgattcatgtaggtcatggagagactgcagatggagtccttgttgatcaggatttgaacgaaccaaccatgggagaaaaacttgctagtttgaatatagtacctgatgatagagtggagagccaaaataaagaaggctcttctctccatgcaaagcctccgagtgcagactctgttcatattttgcttaagcaagcactacacgctgatgaccgtgcccttctattcgagtgcttatacacccaagatgagaaggtcattgcaaagtctgtctctcaattgaatccagctggtgttttgaagctcttacaatctctcatatctcttattgagtcaaggggtgcaattttggcatgtgcacttccatggctaagaagtctacttcttcaacacgcaagtgggatagtgtctcaagaatcttctttaagtgccttgaactctttatatcagctcattgagtccagagtttctacttttcagtcagctcttcaactatcaagtgttttagacttgctgtatacaggggttgttgatgatttggatgatgagaatggcactacaggtccagttatttacgaggacaaagatagtgatgaagaggaatctgaggacgccatggagactgatcaagacagtgaagatggtgaggatttggatgcagaacttggtggtgttagcgactttgaaggaattgaaggacttgatgacttgagcgattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

242

Amino Acids

26.13

Weight (kDa)

4.08

Isoelectric Point (pI)

57.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 388, 527
AcyI GRCGYC 1 cut(s) 621
AfaI GTAC 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 80
AflII CTTAAG 1 cut(s) 197
AgsI TTSAA 9 cut(s) 67, 103, 292, 310, 398, 445, 500, 695, 704
AleI CACNNNNGTG 1 cut(s) 405
AluBI AGCT 4 cut(s) 299, 313, 460, 494
AluI AGCT 4 cut(s) 299, 313, 460, 494
Alw21I GWGCWC 1 cut(s) 370
Alw26I GTCTC 4 cut(s) 26, 286, 423, 623
Alw44I GTGCAC 1 cut(s) 366
AlwNI CAGNNNCTG 1 cut(s) 182
ApaLI GTGCAC 1 cut(s) 366
AspS9I GGNCC 1 cut(s) 572
AsuHPI GGTGA 1 cut(s) 665
AvaII GGWCC 1 cut(s) 572
BaeGI GKGCMC 2 cut(s) 229, 370
Bbv12I GWGCWC 1 cut(s) 370
BccI CCATC 2 cut(s) 35, 644
BclI TGATCA 2 cut(s) 55, 634
BcoDI GTCTC 4 cut(s) 26, 286, 423, 623
BfaI CTAG 1 cut(s) 96
BfmI CTRYAG 2 cut(s) 36, 567
BfrI CTTAAG 1 cut(s) 197
Bme18I GGWCC 1 cut(s) 572
BmgT120I GGNCC 1 cut(s) 572
BmsI GCATC 1 cut(s) 655
BpuEI CTTGAG 1 cut(s) 405
BsaHI GRCGYC 1 cut(s) 621
BsaJI CCNNGG 3 cut(s) 78, 374, 624
BsaXI ACNNNNNCTCC 2 cut(s) 36, 66
Bsc4I CCNNNNNNNGG 1 cut(s) 80
Bse1I ACTGG 1 cut(s) 575
Bse3DI GCAATG 1 cut(s) 267
BseDI CCNNGG 3 cut(s) 78, 374, 624
BseGI GGATG 2 cut(s) 556, 670
BseLI CCNNNNNNNGG 1 cut(s) 80
BseMI GCAATG 1 cut(s) 267
BseMII CTCAG 1 cut(s) 606
BseNI ACTGG 1 cut(s) 575
BseSI GKGCMC 2 cut(s) 229, 370
BsgI GTGCAG 1 cut(s) 195
BsiHKAI GWGCWC 1 cut(s) 370
BslI CCNNNNNNNGG 1 cut(s) 80
BsmAI GTCTC 4 cut(s) 26, 286, 423, 623
Bsp1286I GDGCHC 2 cut(s) 229, 370
Bsp143I GATC 2 cut(s) 55, 634
Bsp19I CCATGG 3 cut(s) 78, 374, 624
BspCNI CTCAG 1 cut(s) 607
BspMAI CTGCAG 1 cut(s) 40
BspQI GCTCTTC 2 cut(s) 154, 501
BspTI CTTAAG 1 cut(s) 197
BsrDI GCAATG 1 cut(s) 267
BsrI ACTGG 1 cut(s) 575
BssECI CCNNGG 3 cut(s) 78, 374, 624
BssMI GATC 2 cut(s) 55, 634
BssNAI GTATAC 1 cut(s) 528
BssNI GRCGYC 1 cut(s) 621
BssT1I CCWWGG 3 cut(s) 78, 374, 624
Bst1107I GTATAC 1 cut(s) 528
Bst4CI ACNGT 2 cut(s) 224, 644
Bst6I CTCTTC 3 cut(s) 154, 501, 600
BstACI GRCGYC 1 cut(s) 621
BstAFI CTTAAG 1 cut(s) 197
BstC8I GCNNGC 1 cut(s) 204
BstDEI CTNAG 2 cut(s) 380, 615
BstDSI CCRYGG 3 cut(s) 78, 374, 624
BstF5I GGATG 2 cut(s) 556, 670
BstKTI GATC 2 cut(s) 58, 637
BstMAI GTCTC 4 cut(s) 26, 286, 423, 623
BstMBI GATC 2 cut(s) 55, 634
BstMWI GCNNNNNNNGC 2 cut(s) 212, 359
BstNSI RCATGY 2 cut(s) 8, 366
BstSFI CTRYAG 2 cut(s) 36, 567
BstSLI GKGCMC 2 cut(s) 229, 370
BstZ17I GTATAC 1 cut(s) 528
BtgI CCRYGG 3 cut(s) 78, 374, 624
BtsCI GGATG 2 cut(s) 556, 670
BtsIMutI CAGTG 1 cut(s) 649
Cac8I GCNNGC 1 cut(s) 204
CaiI CAGNNNCTG 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 572
CseI GACGC 1 cut(s) 629
Csp6I GTAC 1 cut(s) 110
CviAII CATG 8 cut(s) 5, 17, 26, 79, 158, 363, 375, 625
CviJI RGCY 8 cut(s) 132, 147, 166, 299, 313, 379, 460, 494
CviKI_1 RGCY 8 cut(s) 132, 147, 166, 299, 313, 379, 460, 494
CviQI GTAC 1 cut(s) 110
DdeI CTNAG 2 cut(s) 380, 615
DpnI GATC 2 cut(s) 57, 636
DpnII GATC 2 cut(s) 55, 634
Eam1104I CTCTTC 3 cut(s) 154, 501, 600
EarI CTCTTC 3 cut(s) 154, 501, 600
Eco130I CCWWGG 3 cut(s) 78, 374, 624
Eco47I GGWCC 1 cut(s) 572
EcoT14I CCWWGG 3 cut(s) 78, 374, 624
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 3 cut(s) 78, 374, 624
FaeI CATG 8 cut(s) 8, 20, 29, 82, 161, 366, 378, 628
FatI CATG 8 cut(s) 4, 16, 25, 78, 157, 362, 374, 624
FbaI TGATCA 2 cut(s) 55, 634
FblI GTMKAC 2 cut(s) 388, 527
FokI GGATG 2 cut(s) 563, 677
FspBI CTAG 1 cut(s) 96
HgaI GACGC 1 cut(s) 629
Hin1I GRCGYC 1 cut(s) 621
Hin1II CATG 8 cut(s) 8, 20, 29, 82, 161, 366, 378, 628
HinfI GANTC 8 cut(s) 13, 45, 179, 292, 341, 425, 467, 611
HphI GGTGA 1 cut(s) 665
Hpy166II GTNNAC 3 cut(s) 368, 389, 528
Hpy188I TCNGA 2 cut(s) 171, 616
Hpy188III TCNNGA 4 cut(s) 59, 422, 471, 638
Hpy8I GTNNAC 3 cut(s) 368, 389, 528
HpyAV CCTTC 5 cut(s) 137, 239, 256, 689, 698
HpyCH4III ACNGT 2 cut(s) 224, 644
HpyCH4V TGCA 8 cut(s) 4, 38, 161, 176, 272, 353, 368, 668
HpyF10VI GCNNNNNNNGC 2 cut(s) 212, 359
HpyF3I CTNAG 2 cut(s) 380, 615
Hsp92I GRCGYC 1 cut(s) 621
Hsp92II CATG 8 cut(s) 8, 20, 29, 82, 161, 366, 378, 628
Ksp22I TGATCA 2 cut(s) 55, 634
Kzo9I GATC 2 cut(s) 55, 634
LguI GCTCTTC 2 cut(s) 154, 501
LpnPI CCDG 8 cut(s) 44, 126, 285, 309, 484, 516, 555, 588
LweI GCATC 1 cut(s) 655
MaeI CTAG 1 cut(s) 96
MalI GATC 2 cut(s) 57, 636
MboI GATC 2 cut(s) 55, 634
MboII GAAGA 6 cut(s) 141, 386, 420, 488, 617, 659
MfeI CAATTG 1 cut(s) 287
MhlI GDGCHC 2 cut(s) 229, 370
MluCI AATT 3 cut(s) 287, 354, 699
MlyI GAGTC 4 cut(s) 54, 173, 350, 476
MnlI CCTC 5 cut(s) 177, 580, 601, 610, 649
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 198, 434
MslI CAYNNNNRTG 3 cut(s) 216, 373, 405
MspA1I CMGCKG 1 cut(s) 299
MspCI CTTAAG 1 cut(s) 197
MunI CAATTG 1 cut(s) 287
MwoI GCNNNNNNNGC 2 cut(s) 212, 359
NcoI CCATGG 3 cut(s) 78, 374, 624
NdeII GATC 2 cut(s) 55, 634
NlaIII CATG 8 cut(s) 8, 20, 29, 82, 161, 366, 378, 628
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 2 cut(s) 8, 366
OliI CACNNNNGTG 1 cut(s) 405
PciSI GCTCTTC 2 cut(s) 154, 501
PfeI GAWTC 4 cut(s) 13, 292, 425, 611
PleI GAGTC 4 cut(s) 53, 173, 349, 475
PpsI GAGTC 4 cut(s) 53, 173, 349, 475
PspPI GGNCC 1 cut(s) 572
PstI CTGCAG 1 cut(s) 40
PstNI CAGNNNCTG 1 cut(s) 182
PvuII CAGCTG 1 cut(s) 299
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
RseI CAYNNNNRTG 3 cut(s) 216, 373, 405
SapI GCTCTTC 2 cut(s) 154, 501
SaqAI TTAA 2 cut(s) 198, 434
Sau3AI GATC 2 cut(s) 55, 634
Sau96I GGNCC 1 cut(s) 572
SchI GAGTC 4 cut(s) 54, 173, 350, 476
SduI GDGCHC 2 cut(s) 229, 370
SetI ASST 8 cut(s) 25, 115, 267, 301, 315, 462, 496, 574
SfaNI GCATC 1 cut(s) 655
SfcI CTRYAG 2 cut(s) 36, 567
SinI GGWCC 1 cut(s) 572
SmiMI CAYNNNNRTG 3 cut(s) 216, 373, 405
SmlI CTYRAG 3 cut(s) 197, 420, 718
SmoI CTYRAG 3 cut(s) 197, 420, 718
Sse9I AATT 3 cut(s) 287, 354, 699
SspMI CTAG 1 cut(s) 96
StyI CCWWGG 3 cut(s) 78, 374, 624
TaaI ACNGT 2 cut(s) 224, 644
TaqI TCGA 1 cut(s) 237
TasI AATT 3 cut(s) 287, 354, 699
TfiI GAWTC 4 cut(s) 13, 292, 425, 611
Tru1I TTAA 2 cut(s) 198, 434
Tru9I TTAA 2 cut(s) 198, 434
TscAI CASTG 1 cut(s) 649
TspDTI ATGAA 3 cut(s) 5, 176, 618
TspRI CASTG 1 cut(s) 649
Vha464I CTTAAG 1 cut(s) 197
VneI GTGCAC 1 cut(s) 366
VpaK11BI GGWCC 1 cut(s) 572
XceI RCATGY 2 cut(s) 8, 366
XmiI GTMKAC 2 cut(s) 388, 527
XspI CTAG 1 cut(s) 96
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.