Prupe.6G077800_v2.0.a1

Metallothionein-like protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
5300154 .. 5300953
800 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G077800.1

Sequence Viewer

Length: 234 bp
ATGTCTTGCGGCAACGGTAATTGCAGCTGTGGCTCAAACTGCTCCTGCGGCAGTAGCTGCAATTGTGCCTACCCTGACTTGAGTTACTCAGAGACCACTTCTACTGAGACCATCATTGCTGGGGTTGCACCTGTGAAGATGTACTATGAGGGTTCTGAGATGAGCTATGGAGCAGAGAATGACTGCAAGTGTGGAGCAAACTGCAGCTGCAGCTCATGTGGCTGCCACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

7.87

Weight (kDa)

4.49

Isoelectric Point (pI)

70.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 9, 48
AfaI GTAC 1 cut(s) 143
AluBI AGCT 5 cut(s) 27, 57, 165, 207, 213
AluI AGCT 5 cut(s) 27, 57, 165, 207, 213
Alw26I GTCTC 2 cut(s) 86, 101
AlwNI CAGNNNCTG 1 cut(s) 57
ApeKI GCWGC 6 cut(s) 24, 57, 204, 207, 210, 222
BbvI GCAGC 6 cut(s) 36, 44, 194, 209, 216, 222
BccI CCATC 1 cut(s) 119
BcoDI GTCTC 2 cut(s) 86, 101
BfmI CTRYAG 2 cut(s) 202, 208
BisI GCNGC 8 cut(s) 10, 25, 49, 58, 205, 208, 211, 223
BlsI GCNGC 8 cut(s) 11, 26, 50, 59, 206, 209, 212, 224
BpuEI CTTGAG 1 cut(s) 100
BsaI GGTCTC 2 cut(s) 86, 101
Bse3DI GCAATG 1 cut(s) 114
BseMI GCAATG 1 cut(s) 114
BseMII CTCAG 3 cut(s) 96, 102, 147
BseXI GCAGC 6 cut(s) 36, 44, 194, 209, 216, 222
BseYI CCCAGC 1 cut(s) 119
BsmAI GTCTC 2 cut(s) 86, 101
Bso31I GGTCTC 2 cut(s) 86, 101
BspACI CCGC 2 cut(s) 9, 48
BspCNI CTCAG 3 cut(s) 97, 101, 148
BspMAI CTGCAG 2 cut(s) 206, 212
BspTNI GGTCTC 2 cut(s) 86, 101
BsrDI GCAATG 1 cut(s) 114
Bst4CI ACNGT 1 cut(s) 17
BstAPI GCANNNNNTGC 1 cut(s) 57
BstDEI CTNAG 3 cut(s) 88, 105, 156
BstMAI GTCTC 2 cut(s) 86, 101
BstMWI GCNNNNNNNGC 8 cut(s) 30, 39, 48, 54, 57, 125, 210, 219
BstSFI CTRYAG 2 cut(s) 202, 208
BstV1I GCAGC 6 cut(s) 36, 44, 194, 209, 216, 222
CaiI CAGNNNCTG 1 cut(s) 57
Csp6I GTAC 1 cut(s) 142
CviAII CATG 1 cut(s) 216
CviJI RGCY 7 cut(s) 27, 33, 57, 165, 207, 213, 222
CviKI_1 RGCY 7 cut(s) 27, 33, 57, 165, 207, 213, 222
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 3 cut(s) 88, 105, 156
Eco31I GGTCTC 2 cut(s) 86, 101
FaeI CATG 1 cut(s) 219
FaiI YATR 3 cut(s) 147, 168, 217
FatI CATG 1 cut(s) 215
Fnu4HI GCNGC 8 cut(s) 10, 25, 49, 58, 205, 208, 211, 223
Fsp4HI GCNGC 8 cut(s) 10, 25, 49, 58, 205, 208, 211, 223
GluI GCNGC 8 cut(s) 10, 25, 49, 58, 205, 208, 211, 223
GsaI CCCAGC 1 cut(s) 123
Hin1II CATG 1 cut(s) 219
Hpy188I TCNGA 2 cut(s) 91, 157
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 6 cut(s) 24, 60, 128, 186, 204, 210
HpyF10VI GCNNNNNNNGC 8 cut(s) 30, 39, 48, 54, 57, 125, 210, 219
HpyF3I CTNAG 3 cut(s) 88, 105, 156
Hsp92II CATG 1 cut(s) 219
LmnI GCTCC 3 cut(s) 47, 170, 194
LpnPI CCDG 4 cut(s) 58, 87, 105, 144
Lsp1109I GCAGC 6 cut(s) 36, 44, 194, 209, 216, 222
MaeIII GTNAC 1 cut(s) 83
MboII GAAGA 1 cut(s) 148
MfeI CAATTG 1 cut(s) 61
MluCI AATT 2 cut(s) 19, 61
MnlI CCTC 1 cut(s) 142
MspA1I CMGCKG 2 cut(s) 27, 207
MunI CAATTG 1 cut(s) 61
MwoI GCNNNNNNNGC 8 cut(s) 30, 39, 48, 54, 57, 125, 210, 219
NlaIII CATG 1 cut(s) 219
PkrI GCNGC 8 cut(s) 11, 26, 50, 59, 206, 209, 212, 224
PspFI CCCAGC 1 cut(s) 119
PstI CTGCAG 2 cut(s) 206, 212
PstNI CAGNNNCTG 1 cut(s) 57
PvuII CAGCTG 2 cut(s) 27, 207
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SatI GCNGC 8 cut(s) 10, 25, 49, 58, 205, 208, 211, 223
SetI ASST 6 cut(s) 29, 59, 133, 167, 209, 215
SfcI CTRYAG 2 cut(s) 202, 208
SgeI CNNG 8 cut(s) 18, 57, 86, 91, 132, 143, 199, 228
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
Sse9I AATT 2 cut(s) 19, 61
SsiI CCGC 2 cut(s) 9, 48
TaaI ACNGT 1 cut(s) 17
TasI AATT 2 cut(s) 19, 61
TatI WGTACW 1 cut(s) 141
TauI GCSGC 2 cut(s) 12, 51
TseI GCWGC 6 cut(s) 24, 57, 204, 207, 210, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.