Rroxscaffold_1G00016550

Metallothionein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000858
Physical Location & Seq
Reverse (-)
20527164 .. 20528164
1001 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00016550.1

Sequence Viewer

Length: 237 bp
ATGTCTGACTGTGGATCAGCAAGCTGCAAATGCGGCTCTGACTGCCAATGCGGCTCTAGCTGCAACTGTGGACGCCCAGATATAGAGAGCAGCACAACAGCAACCATCATTGCTGGGGTTCCATCAACCAACATGTACTTTGAGGAGTCAGAGATGAGCTTCGGTGCTGAAAATGGCTGCAAGTGCGGCCAAAGCTGCAGCTGCACTCATGCGGCTGCCACAAATGAAAGAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallothio_2

Protein Analysis

78

Amino Acids

7.95

Weight (kDa)

4.44

Isoelectric Point (pI)

75.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Metallothio_2 PF01439 1 - 69 5.5e-12 Metallothionein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 33, 51, 186, 212
AclWI GGATC 1 cut(s) 22
AcoI YGGCCR 1 cut(s) 187
AcyI GRCGYC 1 cut(s) 73
AfaI GTAC 1 cut(s) 137
AflIII ACRYGT 1 cut(s) 132
AluBI AGCT 6 cut(s) 24, 60, 159, 195, 201, 234
AluI AGCT 6 cut(s) 24, 60, 159, 195, 201, 234
AlwI GGATC 1 cut(s) 22
AoxI GGCC 1 cut(s) 187
ApeKI GCWGC 8 cut(s) 24, 60, 90, 177, 195, 198, 201, 215
BbvI GCAGC 8 cut(s) 11, 47, 102, 164, 182, 188, 202, 210
BccI CCATC 2 cut(s) 113, 130
BfaI CTAG 2 cut(s) 57, 235
BfmI CTRYAG 1 cut(s) 196
BglI GCCNNNNNGGC 1 cut(s) 51
BmiI GGNNCC 1 cut(s) 120
BsaHI GRCGYC 1 cut(s) 73
Bse3DI GCAATG 1 cut(s) 108
BseMI GCAATG 1 cut(s) 108
BseRI GAGGAG 1 cut(s) 158
BseXI GCAGC 8 cut(s) 11, 47, 102, 164, 182, 188, 202, 210
BseYI CCCAGC 1 cut(s) 113
BsgI GTGCAG 1 cut(s) 187
BshFI GGCC 1 cut(s) 189
BsnI GGCC 1 cut(s) 189
Bsp143I GATC 1 cut(s) 14
BspACI CCGC 4 cut(s) 33, 51, 186, 212
BspANI GGCC 1 cut(s) 189
BspLI GGNNCC 1 cut(s) 120
BspMAI CTGCAG 1 cut(s) 200
BspPI GGATC 1 cut(s) 22
BsrDI GCAATG 1 cut(s) 108
BssMI GATC 1 cut(s) 14
BssNI GRCGYC 1 cut(s) 73
Bst4CI ACNGT 2 cut(s) 11, 68
BstACI GRCGYC 1 cut(s) 73
BstC8I GCNNGC 1 cut(s) 22
BstKTI GATC 1 cut(s) 17
BstMBI GATC 1 cut(s) 14
BstNSI RCATGY 1 cut(s) 136
BstSFI CTRYAG 1 cut(s) 196
BstV1I GCAGC 8 cut(s) 11, 47, 102, 164, 182, 188, 202, 210
BsuRI GGCC 1 cut(s) 189
Cac8I GCNNGC 1 cut(s) 22
CseI GACGC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 136
CviAII CATG 2 cut(s) 133, 209
CviQI GTAC 1 cut(s) 136
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
EaeI YGGCCR 1 cut(s) 187
FaeI CATG 2 cut(s) 136, 212
FaiI YATR 3 cut(s) 83, 134, 210
FatI CATG 2 cut(s) 132, 208
FspBI CTAG 2 cut(s) 57, 235
GsaI CCCAGC 1 cut(s) 117
HaeIII GGCC 1 cut(s) 189
HgaI GACGC 1 cut(s) 81
Hin1I GRCGYC 1 cut(s) 73
Hin1II CATG 2 cut(s) 136, 212
HinfI GANTC 1 cut(s) 146
Hpy166II GTNNAC 1 cut(s) 71
Hpy188I TCNGA 3 cut(s) 7, 40, 151
Hpy8I GTNNAC 1 cut(s) 71
HpyCH4III ACNGT 2 cut(s) 11, 68
HpyCH4V TGCA 5 cut(s) 27, 63, 180, 198, 204
Hsp92I GRCGYC 1 cut(s) 73
Hsp92II CATG 2 cut(s) 136, 212
Kzo9I GATC 1 cut(s) 14
LpnPI CCDG 2 cut(s) 90, 99
Lsp1109I GCAGC 8 cut(s) 11, 47, 102, 164, 182, 188, 202, 210
MaeI CTAG 2 cut(s) 57, 235
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MlyI GAGTC 1 cut(s) 155
MnlI CCTC 1 cut(s) 136
MspA1I CMGCKG 1 cut(s) 201
NdeII GATC 1 cut(s) 14
NlaIII CATG 2 cut(s) 136, 212
NlaIV GGNNCC 1 cut(s) 120
NspI RCATGY 1 cut(s) 136
PciI ACATGT 1 cut(s) 132
PleI GAGTC 1 cut(s) 154
PpsI GAGTC 1 cut(s) 154
PscI ACATGT 1 cut(s) 132
PspFI CCCAGC 1 cut(s) 113
PspN4I GGNNCC 1 cut(s) 120
PstI CTGCAG 1 cut(s) 200
PvuII CAGCTG 1 cut(s) 201
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
Sau3AI GATC 1 cut(s) 14
SchI GAGTC 1 cut(s) 155
SetI ASST 6 cut(s) 26, 62, 161, 197, 203, 236
SfcI CTRYAG 1 cut(s) 196
SgeI CNNG 7 cut(s) 33, 69, 89, 126, 145, 193, 221
SsiI CCGC 4 cut(s) 33, 51, 186, 212
SspMI CTAG 2 cut(s) 57, 235
TaaI ACNGT 2 cut(s) 11, 68
TatI WGTACW 1 cut(s) 135
TauI GCSGC 4 cut(s) 36, 54, 189, 215
TseI GCWGC 8 cut(s) 24, 60, 90, 177, 195, 198, 201, 215
XceI RCATGY 1 cut(s) 136
XspI CTAG 2 cut(s) 57, 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.